ID: 968601014

View in Genome Browser
Species Human (GRCh38)
Location 4:1509352-1509374
Sequence TGGGGTCTCCTTTTAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968601003_968601014 27 Left 968601003 4:1509302-1509324 CCTCCAGCAGCAGCTTGCTTGCC No data
Right 968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG No data
968601006_968601014 6 Left 968601006 4:1509323-1509345 CCTCCCATTGGTCAAGAGCAGAC No data
Right 968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG No data
968601008_968601014 2 Left 968601008 4:1509327-1509349 CCATTGGTCAAGAGCAGACAGCC No data
Right 968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG No data
968601004_968601014 24 Left 968601004 4:1509305-1509327 CCAGCAGCAGCTTGCTTGCCTCC No data
Right 968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG No data
968601007_968601014 3 Left 968601007 4:1509326-1509348 CCCATTGGTCAAGAGCAGACAGC No data
Right 968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG No data
968601002_968601014 28 Left 968601002 4:1509301-1509323 CCCTCCAGCAGCAGCTTGCTTGC No data
Right 968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968601014 Original CRISPR TGGGGTCTCCTTTTAAAAGC AGG Intergenic
No off target data available for this crispr