ID: 968601880

View in Genome Browser
Species Human (GRCh38)
Location 4:1513373-1513395
Sequence GTGCGCGGCGCCGGAGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968601863_968601880 30 Left 968601863 4:1513320-1513342 CCACATCGGTGGAGCAGGGCGAG No data
Right 968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG No data
968601870_968601880 1 Left 968601870 4:1513349-1513371 CCTGGCGGCGGGCCCTCCCCTCC No data
Right 968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG No data
968601869_968601880 4 Left 968601869 4:1513346-1513368 CCACCTGGCGGCGGGCCCTCCCC No data
Right 968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968601880 Original CRISPR GTGCGCGGCGCCGGAGCCGC TGG Intergenic
No off target data available for this crispr