ID: 968602262

View in Genome Browser
Species Human (GRCh38)
Location 4:1515782-1515804
Sequence ATGGAGAAGCCCATAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968602262_968602271 24 Left 968602262 4:1515782-1515804 CCTGCCTCTATGGGCTTCTCCAT No data
Right 968602271 4:1515829-1515851 AGCCACTGGCTTCCCCCAAGGGG No data
968602262_968602265 -8 Left 968602262 4:1515782-1515804 CCTGCCTCTATGGGCTTCTCCAT No data
Right 968602265 4:1515797-1515819 TTCTCCATAGGCTGTCTGAGTGG No data
968602262_968602270 23 Left 968602262 4:1515782-1515804 CCTGCCTCTATGGGCTTCTCCAT No data
Right 968602270 4:1515828-1515850 CAGCCACTGGCTTCCCCCAAGGG No data
968602262_968602269 22 Left 968602262 4:1515782-1515804 CCTGCCTCTATGGGCTTCTCCAT No data
Right 968602269 4:1515827-1515849 CCAGCCACTGGCTTCCCCCAAGG No data
968602262_968602267 10 Left 968602262 4:1515782-1515804 CCTGCCTCTATGGGCTTCTCCAT No data
Right 968602267 4:1515815-1515837 AGTGGACTCACTCCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968602262 Original CRISPR ATGGAGAAGCCCATAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr