ID: 968602598

View in Genome Browser
Species Human (GRCh38)
Location 4:1517391-1517413
Sequence CCACCATGGTGTGGGTGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968602598_968602611 14 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602611 4:1517428-1517450 TGGCCCCCAGTGGGTGACTGGGG No data
968602598_968602610 13 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602610 4:1517427-1517449 CTGGCCCCCAGTGGGTGACTGGG No data
968602598_968602609 12 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602598_968602608 5 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602598_968602606 -6 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602606 4:1517408-1517430 TGGTGGCTCTGGGGAGCGACTGG No data
968602598_968602616 27 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602616 4:1517441-1517463 GTGACTGGGGTCAGACCCTGTGG No data
968602598_968602607 4 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602607 4:1517418-1517440 GGGGAGCGACTGGCCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968602598 Original CRISPR CCACCATGGTGTGGGTGTGC CGG (reversed) Intergenic
No off target data available for this crispr