ID: 968602606

View in Genome Browser
Species Human (GRCh38)
Location 4:1517408-1517430
Sequence TGGTGGCTCTGGGGAGCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968602593_968602606 -2 Left 968602593 4:1517387-1517409 CCCCCCGGCACACCCACACCATG No data
Right 968602606 4:1517408-1517430 TGGTGGCTCTGGGGAGCGACTGG No data
968602596_968602606 -4 Left 968602596 4:1517389-1517411 CCCCGGCACACCCACACCATGGT No data
Right 968602606 4:1517408-1517430 TGGTGGCTCTGGGGAGCGACTGG No data
968602597_968602606 -5 Left 968602597 4:1517390-1517412 CCCGGCACACCCACACCATGGTG No data
Right 968602606 4:1517408-1517430 TGGTGGCTCTGGGGAGCGACTGG No data
968602598_968602606 -6 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602606 4:1517408-1517430 TGGTGGCTCTGGGGAGCGACTGG No data
968602591_968602606 17 Left 968602591 4:1517368-1517390 CCTGGGCATCTAGGCAGAACCCC No data
Right 968602606 4:1517408-1517430 TGGTGGCTCTGGGGAGCGACTGG No data
968602594_968602606 -3 Left 968602594 4:1517388-1517410 CCCCCGGCACACCCACACCATGG No data
Right 968602606 4:1517408-1517430 TGGTGGCTCTGGGGAGCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968602606 Original CRISPR TGGTGGCTCTGGGGAGCGAC TGG Intergenic
No off target data available for this crispr