ID: 968602608

View in Genome Browser
Species Human (GRCh38)
Location 4:1517419-1517441
Sequence GGGAGCGACTGGCCCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968602604_968602608 -4 Left 968602604 4:1517400-1517422 CCACACCATGGTGGCTCTGGGGA No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602605_968602608 -9 Left 968602605 4:1517405-1517427 CCATGGTGGCTCTGGGGAGCGAC No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602591_968602608 28 Left 968602591 4:1517368-1517390 CCTGGGCATCTAGGCAGAACCCC No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602593_968602608 9 Left 968602593 4:1517387-1517409 CCCCCCGGCACACCCACACCATG No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602598_968602608 5 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602602_968602608 -3 Left 968602602 4:1517399-1517421 CCCACACCATGGTGGCTCTGGGG No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602594_968602608 8 Left 968602594 4:1517388-1517410 CCCCCGGCACACCCACACCATGG No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602597_968602608 6 Left 968602597 4:1517390-1517412 CCCGGCACACCCACACCATGGTG No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data
968602596_968602608 7 Left 968602596 4:1517389-1517411 CCCCGGCACACCCACACCATGGT No data
Right 968602608 4:1517419-1517441 GGGAGCGACTGGCCCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968602608 Original CRISPR GGGAGCGACTGGCCCCCAGT GGG Intergenic
No off target data available for this crispr