ID: 968602609

View in Genome Browser
Species Human (GRCh38)
Location 4:1517426-1517448
Sequence ACTGGCCCCCAGTGGGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968602602_968602609 4 Left 968602602 4:1517399-1517421 CCCACACCATGGTGGCTCTGGGG No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602605_968602609 -2 Left 968602605 4:1517405-1517427 CCATGGTGGCTCTGGGGAGCGAC No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602598_968602609 12 Left 968602598 4:1517391-1517413 CCGGCACACCCACACCATGGTGG No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602596_968602609 14 Left 968602596 4:1517389-1517411 CCCCGGCACACCCACACCATGGT No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602597_968602609 13 Left 968602597 4:1517390-1517412 CCCGGCACACCCACACCATGGTG No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602604_968602609 3 Left 968602604 4:1517400-1517422 CCACACCATGGTGGCTCTGGGGA No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602593_968602609 16 Left 968602593 4:1517387-1517409 CCCCCCGGCACACCCACACCATG No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data
968602594_968602609 15 Left 968602594 4:1517388-1517410 CCCCCGGCACACCCACACCATGG No data
Right 968602609 4:1517426-1517448 ACTGGCCCCCAGTGGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968602609 Original CRISPR ACTGGCCCCCAGTGGGTGAC TGG Intergenic
No off target data available for this crispr