ID: 968603266

View in Genome Browser
Species Human (GRCh38)
Location 4:1520346-1520368
Sequence GCTGGTTCGATCCCCGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603266_968603271 7 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603271 4:1520376-1520398 GCCTGCTGAGCCCAGAAGGGCGG No data
968603266_968603269 3 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603269 4:1520372-1520394 CAAAGCCTGCTGAGCCCAGAAGG No data
968603266_968603276 20 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603276 4:1520389-1520411 AGAAGGGCGGAAGCCAGGCTCGG No data
968603266_968603278 22 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603278 4:1520391-1520413 AAGGGCGGAAGCCAGGCTCGGGG No data
968603266_968603277 21 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603277 4:1520390-1520412 GAAGGGCGGAAGCCAGGCTCGGG No data
968603266_968603273 15 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603273 4:1520384-1520406 AGCCCAGAAGGGCGGAAGCCAGG No data
968603266_968603280 26 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG No data
968603266_968603279 25 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603279 4:1520394-1520416 GGCGGAAGCCAGGCTCGGGGAGG No data
968603266_968603270 4 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603270 4:1520373-1520395 AAAGCCTGCTGAGCCCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603266 Original CRISPR GCTGGTTCGATCCCCGCCCC TGG (reversed) Intergenic
No off target data available for this crispr