ID: 968603268

View in Genome Browser
Species Human (GRCh38)
Location 4:1520371-1520393
Sequence CTTCTGGGCTCAGCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603268_968603285 19 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603285 4:1520413-1520435 GAGGGAACGGCTGGAAAGGCAGG No data
968603268_968603288 28 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603288 4:1520422-1520444 GCTGGAAAGGCAGGGCGGAAAGG No data
968603268_968603279 0 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603279 4:1520394-1520416 GGCGGAAGCCAGGCTCGGGGAGG No data
968603268_968603273 -10 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603273 4:1520384-1520406 AGCCCAGAAGGGCGGAAGCCAGG No data
968603268_968603277 -4 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603277 4:1520390-1520412 GAAGGGCGGAAGCCAGGCTCGGG No data
968603268_968603284 15 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603284 4:1520409-1520431 CGGGGAGGGAACGGCTGGAAAGG No data
968603268_968603281 6 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603281 4:1520400-1520422 AGCCAGGCTCGGGGAGGGAACGG No data
968603268_968603283 10 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603283 4:1520404-1520426 AGGCTCGGGGAGGGAACGGCTGG No data
968603268_968603280 1 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG No data
968603268_968603286 20 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603286 4:1520414-1520436 AGGGAACGGCTGGAAAGGCAGGG No data
968603268_968603287 23 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603287 4:1520417-1520439 GAACGGCTGGAAAGGCAGGGCGG No data
968603268_968603276 -5 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603276 4:1520389-1520411 AGAAGGGCGGAAGCCAGGCTCGG No data
968603268_968603278 -3 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603278 4:1520391-1520413 AAGGGCGGAAGCCAGGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603268 Original CRISPR CTTCTGGGCTCAGCAGGCTT TGG (reversed) Intergenic
No off target data available for this crispr