ID: 968603272

View in Genome Browser
Species Human (GRCh38)
Location 4:1520377-1520399
Sequence TCCGCCCTTCTGGGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603272_968603280 -5 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG No data
968603272_968603285 13 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603285 4:1520413-1520435 GAGGGAACGGCTGGAAAGGCAGG No data
968603272_968603287 17 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603287 4:1520417-1520439 GAACGGCTGGAAAGGCAGGGCGG No data
968603272_968603288 22 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603288 4:1520422-1520444 GCTGGAAAGGCAGGGCGGAAAGG No data
968603272_968603286 14 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603286 4:1520414-1520436 AGGGAACGGCTGGAAAGGCAGGG No data
968603272_968603289 30 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603289 4:1520430-1520452 GGCAGGGCGGAAAGGCTCCCTGG No data
968603272_968603277 -10 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603277 4:1520390-1520412 GAAGGGCGGAAGCCAGGCTCGGG No data
968603272_968603281 0 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603281 4:1520400-1520422 AGCCAGGCTCGGGGAGGGAACGG No data
968603272_968603278 -9 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603278 4:1520391-1520413 AAGGGCGGAAGCCAGGCTCGGGG No data
968603272_968603283 4 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603283 4:1520404-1520426 AGGCTCGGGGAGGGAACGGCTGG No data
968603272_968603284 9 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603284 4:1520409-1520431 CGGGGAGGGAACGGCTGGAAAGG No data
968603272_968603279 -6 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603279 4:1520394-1520416 GGCGGAAGCCAGGCTCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603272 Original CRISPR TCCGCCCTTCTGGGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr