ID: 968603273

View in Genome Browser
Species Human (GRCh38)
Location 4:1520384-1520406
Sequence AGCCCAGAAGGGCGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603262_968603273 30 Left 968603262 4:1520331-1520353 CCACGGGGATGGTTTCCAGGGGC No data
Right 968603273 4:1520384-1520406 AGCCCAGAAGGGCGGAAGCCAGG No data
968603268_968603273 -10 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603273 4:1520384-1520406 AGCCCAGAAGGGCGGAAGCCAGG No data
968603266_968603273 15 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603273 4:1520384-1520406 AGCCCAGAAGGGCGGAAGCCAGG No data
968603267_968603273 -3 Left 968603267 4:1520364-1520386 CCAGCGTCCAAAGCCTGCTGAGC No data
Right 968603273 4:1520384-1520406 AGCCCAGAAGGGCGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603273 Original CRISPR AGCCCAGAAGGGCGGAAGCC AGG Intergenic