ID: 968603276

View in Genome Browser
Species Human (GRCh38)
Location 4:1520389-1520411
Sequence AGAAGGGCGGAAGCCAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603267_968603276 2 Left 968603267 4:1520364-1520386 CCAGCGTCCAAAGCCTGCTGAGC No data
Right 968603276 4:1520389-1520411 AGAAGGGCGGAAGCCAGGCTCGG No data
968603268_968603276 -5 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603276 4:1520389-1520411 AGAAGGGCGGAAGCCAGGCTCGG No data
968603266_968603276 20 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603276 4:1520389-1520411 AGAAGGGCGGAAGCCAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603276 Original CRISPR AGAAGGGCGGAAGCCAGGCT CGG Intergenic