ID: 968603279

View in Genome Browser
Species Human (GRCh38)
Location 4:1520394-1520416
Sequence GGCGGAAGCCAGGCTCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603267_968603279 7 Left 968603267 4:1520364-1520386 CCAGCGTCCAAAGCCTGCTGAGC No data
Right 968603279 4:1520394-1520416 GGCGGAAGCCAGGCTCGGGGAGG No data
968603266_968603279 25 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603279 4:1520394-1520416 GGCGGAAGCCAGGCTCGGGGAGG No data
968603272_968603279 -6 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603279 4:1520394-1520416 GGCGGAAGCCAGGCTCGGGGAGG No data
968603268_968603279 0 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603279 4:1520394-1520416 GGCGGAAGCCAGGCTCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603279 Original CRISPR GGCGGAAGCCAGGCTCGGGG AGG Intergenic