ID: 968603280

View in Genome Browser
Species Human (GRCh38)
Location 4:1520395-1520417
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603272_968603280 -5 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG No data
968603268_968603280 1 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG No data
968603266_968603280 26 Left 968603266 4:1520346-1520368 CCAGGGGCGGGGATCGAACCAGC No data
Right 968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG No data
968603267_968603280 8 Left 968603267 4:1520364-1520386 CCAGCGTCCAAAGCCTGCTGAGC No data
Right 968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type