ID: 968603281

View in Genome Browser
Species Human (GRCh38)
Location 4:1520400-1520422
Sequence AGCCAGGCTCGGGGAGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603275_968603281 -10 Left 968603275 4:1520387-1520409 CCAGAAGGGCGGAAGCCAGGCTC No data
Right 968603281 4:1520400-1520422 AGCCAGGCTCGGGGAGGGAACGG No data
968603268_968603281 6 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603281 4:1520400-1520422 AGCCAGGCTCGGGGAGGGAACGG No data
968603272_968603281 0 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603281 4:1520400-1520422 AGCCAGGCTCGGGGAGGGAACGG No data
968603267_968603281 13 Left 968603267 4:1520364-1520386 CCAGCGTCCAAAGCCTGCTGAGC No data
Right 968603281 4:1520400-1520422 AGCCAGGCTCGGGGAGGGAACGG No data
968603274_968603281 -9 Left 968603274 4:1520386-1520408 CCCAGAAGGGCGGAAGCCAGGCT No data
Right 968603281 4:1520400-1520422 AGCCAGGCTCGGGGAGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603281 Original CRISPR AGCCAGGCTCGGGGAGGGAA CGG Intergenic