ID: 968603285

View in Genome Browser
Species Human (GRCh38)
Location 4:1520413-1520435
Sequence GAGGGAACGGCTGGAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603268_968603285 19 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603285 4:1520413-1520435 GAGGGAACGGCTGGAAAGGCAGG No data
968603274_968603285 4 Left 968603274 4:1520386-1520408 CCCAGAAGGGCGGAAGCCAGGCT No data
Right 968603285 4:1520413-1520435 GAGGGAACGGCTGGAAAGGCAGG No data
968603267_968603285 26 Left 968603267 4:1520364-1520386 CCAGCGTCCAAAGCCTGCTGAGC No data
Right 968603285 4:1520413-1520435 GAGGGAACGGCTGGAAAGGCAGG No data
968603275_968603285 3 Left 968603275 4:1520387-1520409 CCAGAAGGGCGGAAGCCAGGCTC No data
Right 968603285 4:1520413-1520435 GAGGGAACGGCTGGAAAGGCAGG No data
968603272_968603285 13 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603285 4:1520413-1520435 GAGGGAACGGCTGGAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603285 Original CRISPR GAGGGAACGGCTGGAAAGGC AGG Intergenic