ID: 968603286

View in Genome Browser
Species Human (GRCh38)
Location 4:1520414-1520436
Sequence AGGGAACGGCTGGAAAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603275_968603286 4 Left 968603275 4:1520387-1520409 CCAGAAGGGCGGAAGCCAGGCTC No data
Right 968603286 4:1520414-1520436 AGGGAACGGCTGGAAAGGCAGGG No data
968603268_968603286 20 Left 968603268 4:1520371-1520393 CCAAAGCCTGCTGAGCCCAGAAG No data
Right 968603286 4:1520414-1520436 AGGGAACGGCTGGAAAGGCAGGG No data
968603274_968603286 5 Left 968603274 4:1520386-1520408 CCCAGAAGGGCGGAAGCCAGGCT No data
Right 968603286 4:1520414-1520436 AGGGAACGGCTGGAAAGGCAGGG No data
968603267_968603286 27 Left 968603267 4:1520364-1520386 CCAGCGTCCAAAGCCTGCTGAGC No data
Right 968603286 4:1520414-1520436 AGGGAACGGCTGGAAAGGCAGGG No data
968603272_968603286 14 Left 968603272 4:1520377-1520399 CCTGCTGAGCCCAGAAGGGCGGA No data
Right 968603286 4:1520414-1520436 AGGGAACGGCTGGAAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603286 Original CRISPR AGGGAACGGCTGGAAAGGCA GGG Intergenic