ID: 968603329

View in Genome Browser
Species Human (GRCh38)
Location 4:1520608-1520630
Sequence GGTCGCCGCCGCGTAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603329_968603346 22 Left 968603329 4:1520608-1520630 CCCCTCCCTACGCGGCGGCGACC No data
Right 968603346 4:1520653-1520675 CAGCCCCTCCGAGGCCGCCCCGG No data
968603329_968603347 23 Left 968603329 4:1520608-1520630 CCCCTCCCTACGCGGCGGCGACC No data
Right 968603347 4:1520654-1520676 AGCCCCTCCGAGGCCGCCCCGGG No data
968603329_968603348 24 Left 968603329 4:1520608-1520630 CCCCTCCCTACGCGGCGGCGACC No data
Right 968603348 4:1520655-1520677 GCCCCTCCGAGGCCGCCCCGGGG No data
968603329_968603341 13 Left 968603329 4:1520608-1520630 CCCCTCCCTACGCGGCGGCGACC No data
Right 968603341 4:1520644-1520666 TCCCTCCTCCAGCCCCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603329 Original CRISPR GGTCGCCGCCGCGTAGGGAG GGG (reversed) Intergenic
No off target data available for this crispr