ID: 968603981

View in Genome Browser
Species Human (GRCh38)
Location 4:1522872-1522894
Sequence TGCTAGGGATGGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968603981_968603990 0 Left 968603981 4:1522872-1522894 CCATCTGCCCTCCATCCCTAGCA No data
Right 968603990 4:1522895-1522917 CTGGGTGATGGCTTCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968603981 Original CRISPR TGCTAGGGATGGAGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr