ID: 968605237

View in Genome Browser
Species Human (GRCh38)
Location 4:1532272-1532294
Sequence CCTCCTGGCCCACCAGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968605237_968605244 8 Left 968605237 4:1532272-1532294 CCGAGGGCTGGTGGGCCAGGAGG No data
Right 968605244 4:1532303-1532325 GCCCCCCAGCAGGTTGGCGCAGG No data
968605237_968605250 28 Left 968605237 4:1532272-1532294 CCGAGGGCTGGTGGGCCAGGAGG No data
Right 968605250 4:1532323-1532345 AGGCCATACCTCTCTGAATCTGG No data
968605237_968605243 2 Left 968605237 4:1532272-1532294 CCGAGGGCTGGTGGGCCAGGAGG No data
Right 968605243 4:1532297-1532319 AGGGTTGCCCCCCAGCAGGTTGG No data
968605237_968605242 -2 Left 968605237 4:1532272-1532294 CCGAGGGCTGGTGGGCCAGGAGG No data
Right 968605242 4:1532293-1532315 GGACAGGGTTGCCCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968605237 Original CRISPR CCTCCTGGCCCACCAGCCCT CGG (reversed) Intergenic
No off target data available for this crispr