ID: 968605243

View in Genome Browser
Species Human (GRCh38)
Location 4:1532297-1532319
Sequence AGGGTTGCCCCCCAGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968605237_968605243 2 Left 968605237 4:1532272-1532294 CCGAGGGCTGGTGGGCCAGGAGG No data
Right 968605243 4:1532297-1532319 AGGGTTGCCCCCCAGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968605243 Original CRISPR AGGGTTGCCCCCCAGCAGGT TGG Intergenic
No off target data available for this crispr