ID: 968606209

View in Genome Browser
Species Human (GRCh38)
Location 4:1536879-1536901
Sequence GGTTTCATGCTCCTGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606209_968606218 30 Left 968606209 4:1536879-1536901 CCAATTTCCAGGAGCATGAAACC No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data
968606209_968606216 13 Left 968606209 4:1536879-1536901 CCAATTTCCAGGAGCATGAAACC No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data
968606209_968606211 -6 Left 968606209 4:1536879-1536901 CCAATTTCCAGGAGCATGAAACC No data
Right 968606211 4:1536896-1536918 GAAACCATTTTTTGCCCAGCAGG No data
968606209_968606212 -5 Left 968606209 4:1536879-1536901 CCAATTTCCAGGAGCATGAAACC No data
Right 968606212 4:1536897-1536919 AAACCATTTTTTGCCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606209 Original CRISPR GGTTTCATGCTCCTGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr