ID: 968606210

View in Genome Browser
Species Human (GRCh38)
Location 4:1536886-1536908
Sequence AAAAAATGGTTTCATGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606210_968606216 6 Left 968606210 4:1536886-1536908 CCAGGAGCATGAAACCATTTTTT No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data
968606210_968606218 23 Left 968606210 4:1536886-1536908 CCAGGAGCATGAAACCATTTTTT No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606210 Original CRISPR AAAAAATGGTTTCATGCTCC TGG (reversed) Intergenic
No off target data available for this crispr