ID: 968606213

View in Genome Browser
Species Human (GRCh38)
Location 4:1536900-1536922
Sequence GCACCCTGCTGGGCAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606213_968606218 9 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data
968606213_968606220 24 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606220 4:1536947-1536969 GAAAGAGGCCACATCAAGACCGG No data
968606213_968606221 28 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606221 4:1536951-1536973 GAGGCCACATCAAGACCGGCAGG No data
968606213_968606222 29 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606222 4:1536952-1536974 AGGCCACATCAAGACCGGCAGGG No data
968606213_968606216 -8 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606213 Original CRISPR GCACCCTGCTGGGCAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr