ID: 968606214

View in Genome Browser
Species Human (GRCh38)
Location 4:1536910-1536932
Sequence TTGGACATTAGCACCCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606214_968606221 18 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606221 4:1536951-1536973 GAGGCCACATCAAGACCGGCAGG No data
968606214_968606220 14 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606220 4:1536947-1536969 GAAAGAGGCCACATCAAGACCGG No data
968606214_968606218 -1 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data
968606214_968606222 19 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606222 4:1536952-1536974 AGGCCACATCAAGACCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606214 Original CRISPR TTGGACATTAGCACCCTGCT GGG (reversed) Intergenic
No off target data available for this crispr