ID: 968606216

View in Genome Browser
Species Human (GRCh38)
Location 4:1536915-1536937
Sequence CAGGGTGCTAATGTCCAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606207_968606216 17 Left 968606207 4:1536875-1536897 CCCGCCAATTTCCAGGAGCATGA No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data
968606210_968606216 6 Left 968606210 4:1536886-1536908 CCAGGAGCATGAAACCATTTTTT No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data
968606206_968606216 18 Left 968606206 4:1536874-1536896 CCCCGCCAATTTCCAGGAGCATG No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data
968606208_968606216 16 Left 968606208 4:1536876-1536898 CCGCCAATTTCCAGGAGCATGAA No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data
968606209_968606216 13 Left 968606209 4:1536879-1536901 CCAATTTCCAGGAGCATGAAACC No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data
968606213_968606216 -8 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606216 4:1536915-1536937 CAGGGTGCTAATGTCCAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606216 Original CRISPR CAGGGTGCTAATGTCCAATG CGG Intergenic
No off target data available for this crispr