ID: 968606218

View in Genome Browser
Species Human (GRCh38)
Location 4:1536932-1536954
Sequence ATGCGGCCGAAAGCAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606215_968606218 -2 Left 968606215 4:1536911-1536933 CCAGCAGGGTGCTAATGTCCAAT No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data
968606213_968606218 9 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data
968606209_968606218 30 Left 968606209 4:1536879-1536901 CCAATTTCCAGGAGCATGAAACC No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data
968606214_968606218 -1 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data
968606210_968606218 23 Left 968606210 4:1536886-1536908 CCAGGAGCATGAAACCATTTTTT No data
Right 968606218 4:1536932-1536954 ATGCGGCCGAAAGCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606218 Original CRISPR ATGCGGCCGAAAGCAGAAAG AGG Intergenic
No off target data available for this crispr