ID: 968606220

View in Genome Browser
Species Human (GRCh38)
Location 4:1536947-1536969
Sequence GAAAGAGGCCACATCAAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606217_968606220 -5 Left 968606217 4:1536929-1536951 CCAATGCGGCCGAAAGCAGAAAG No data
Right 968606220 4:1536947-1536969 GAAAGAGGCCACATCAAGACCGG No data
968606214_968606220 14 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606220 4:1536947-1536969 GAAAGAGGCCACATCAAGACCGG No data
968606215_968606220 13 Left 968606215 4:1536911-1536933 CCAGCAGGGTGCTAATGTCCAAT No data
Right 968606220 4:1536947-1536969 GAAAGAGGCCACATCAAGACCGG No data
968606213_968606220 24 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606220 4:1536947-1536969 GAAAGAGGCCACATCAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606220 Original CRISPR GAAAGAGGCCACATCAAGAC CGG Intergenic
No off target data available for this crispr