ID: 968606221

View in Genome Browser
Species Human (GRCh38)
Location 4:1536951-1536973
Sequence GAGGCCACATCAAGACCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606213_968606221 28 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606221 4:1536951-1536973 GAGGCCACATCAAGACCGGCAGG No data
968606219_968606221 -10 Left 968606219 4:1536938-1536960 CCGAAAGCAGAAAGAGGCCACAT No data
Right 968606221 4:1536951-1536973 GAGGCCACATCAAGACCGGCAGG No data
968606217_968606221 -1 Left 968606217 4:1536929-1536951 CCAATGCGGCCGAAAGCAGAAAG No data
Right 968606221 4:1536951-1536973 GAGGCCACATCAAGACCGGCAGG No data
968606214_968606221 18 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606221 4:1536951-1536973 GAGGCCACATCAAGACCGGCAGG No data
968606215_968606221 17 Left 968606215 4:1536911-1536933 CCAGCAGGGTGCTAATGTCCAAT No data
Right 968606221 4:1536951-1536973 GAGGCCACATCAAGACCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606221 Original CRISPR GAGGCCACATCAAGACCGGC AGG Intergenic
No off target data available for this crispr