ID: 968606222

View in Genome Browser
Species Human (GRCh38)
Location 4:1536952-1536974
Sequence AGGCCACATCAAGACCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968606214_968606222 19 Left 968606214 4:1536910-1536932 CCCAGCAGGGTGCTAATGTCCAA No data
Right 968606222 4:1536952-1536974 AGGCCACATCAAGACCGGCAGGG No data
968606217_968606222 0 Left 968606217 4:1536929-1536951 CCAATGCGGCCGAAAGCAGAAAG No data
Right 968606222 4:1536952-1536974 AGGCCACATCAAGACCGGCAGGG No data
968606215_968606222 18 Left 968606215 4:1536911-1536933 CCAGCAGGGTGCTAATGTCCAAT No data
Right 968606222 4:1536952-1536974 AGGCCACATCAAGACCGGCAGGG No data
968606213_968606222 29 Left 968606213 4:1536900-1536922 CCATTTTTTGCCCAGCAGGGTGC No data
Right 968606222 4:1536952-1536974 AGGCCACATCAAGACCGGCAGGG No data
968606219_968606222 -9 Left 968606219 4:1536938-1536960 CCGAAAGCAGAAAGAGGCCACAT No data
Right 968606222 4:1536952-1536974 AGGCCACATCAAGACCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968606222 Original CRISPR AGGCCACATCAAGACCGGCA GGG Intergenic
No off target data available for this crispr