ID: 968607519

View in Genome Browser
Species Human (GRCh38)
Location 4:1542484-1542506
Sequence TGGGTTTATCTTACAAACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968607511_968607519 3 Left 968607511 4:1542458-1542480 CCCCAGCACAGCACGTTCCAAGG No data
Right 968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG No data
968607509_968607519 20 Left 968607509 4:1542441-1542463 CCCAAGCAGGAGCGTCACCCCAG No data
Right 968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG No data
968607508_968607519 23 Left 968607508 4:1542438-1542460 CCTCCCAAGCAGGAGCGTCACCC No data
Right 968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG No data
968607513_968607519 2 Left 968607513 4:1542459-1542481 CCCAGCACAGCACGTTCCAAGGC No data
Right 968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG No data
968607510_968607519 19 Left 968607510 4:1542442-1542464 CCAAGCAGGAGCGTCACCCCAGC No data
Right 968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG No data
968607507_968607519 27 Left 968607507 4:1542434-1542456 CCAACCTCCCAAGCAGGAGCGTC No data
Right 968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG No data
968607514_968607519 1 Left 968607514 4:1542460-1542482 CCAGCACAGCACGTTCCAAGGCT No data
Right 968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968607519 Original CRISPR TGGGTTTATCTTACAAACAC GGG Intergenic
No off target data available for this crispr