ID: 968607940

View in Genome Browser
Species Human (GRCh38)
Location 4:1544396-1544418
Sequence CATTCTGAGGTGCTGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968607940_968607947 17 Left 968607940 4:1544396-1544418 CCAGCCCCCAGCACCTCAGAATG No data
Right 968607947 4:1544436-1544458 GAGTCTTTACAGAGAAAATCAGG No data
968607940_968607949 24 Left 968607940 4:1544396-1544418 CCAGCCCCCAGCACCTCAGAATG No data
Right 968607949 4:1544443-1544465 TACAGAGAAAATCAGGTTAAGGG No data
968607940_968607950 25 Left 968607940 4:1544396-1544418 CCAGCCCCCAGCACCTCAGAATG No data
Right 968607950 4:1544444-1544466 ACAGAGAAAATCAGGTTAAGGGG No data
968607940_968607948 23 Left 968607940 4:1544396-1544418 CCAGCCCCCAGCACCTCAGAATG No data
Right 968607948 4:1544442-1544464 TTACAGAGAAAATCAGGTTAAGG No data
968607940_968607951 28 Left 968607940 4:1544396-1544418 CCAGCCCCCAGCACCTCAGAATG No data
Right 968607951 4:1544447-1544469 GAGAAAATCAGGTTAAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968607940 Original CRISPR CATTCTGAGGTGCTGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr