ID: 968608004

View in Genome Browser
Species Human (GRCh38)
Location 4:1544653-1544675
Sequence CCTCGCAGCCTCGGAGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968607993_968608004 16 Left 968607993 4:1544614-1544636 CCGCCACGGGGAGCTGGGGAGAG No data
Right 968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG No data
968607986_968608004 30 Left 968607986 4:1544600-1544622 CCGAGGGCTGCTGGCCGCCACGG No data
Right 968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG No data
968607995_968608004 13 Left 968607995 4:1544617-1544639 CCACGGGGAGCTGGGGAGAGGAT No data
Right 968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968608004 Original CRISPR CCTCGCAGCCTCGGAGGAGC CGG Intergenic
No off target data available for this crispr