ID: 968609450

View in Genome Browser
Species Human (GRCh38)
Location 4:1550418-1550440
Sequence CAGGTGGCGAGCGTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968609444_968609450 10 Left 968609444 4:1550385-1550407 CCTGGAGGCTACAGGGAGCAAAG 0: 1
1: 0
2: 5
3: 76
4: 563
Right 968609450 4:1550418-1550440 CAGGTGGCGAGCGTGTTCTCAGG 0: 1
1: 0
2: 1
3: 4
4: 64
968609438_968609450 30 Left 968609438 4:1550365-1550387 CCCTGGTGGGTCAGAGATCTCCT No data
Right 968609450 4:1550418-1550440 CAGGTGGCGAGCGTGTTCTCAGG 0: 1
1: 0
2: 1
3: 4
4: 64
968609439_968609450 29 Left 968609439 4:1550366-1550388 CCTGGTGGGTCAGAGATCTCCTG No data
Right 968609450 4:1550418-1550440 CAGGTGGCGAGCGTGTTCTCAGG 0: 1
1: 0
2: 1
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968609450 Original CRISPR CAGGTGGCGAGCGTGTTCTC AGG Intergenic
901034317 1:6327175-6327197 CAGGTGCTGAGCATGCTCTCCGG - Intronic
901672817 1:10866292-10866314 CAGGTGGAGGGCGTGGGCTCAGG - Intergenic
902205153 1:14863110-14863132 CAGGTGGTGAGCTTGCTCTGGGG + Intronic
903424796 1:23245675-23245697 CAGGGGACTAGCTTGTTCTCAGG - Intergenic
903926422 1:26833899-26833921 CAGCTGGAGAGGATGTTCTCTGG + Intronic
907704261 1:56819413-56819435 CAGGTGGGGAGCCTGGGCTCAGG - Intronic
913130837 1:115837817-115837839 CAGGTAGCGAGCTTCTTCCCCGG + Exonic
920073778 1:203322076-203322098 CAGGTGGATAGCGTGAACTCAGG - Intergenic
921363166 1:214349192-214349214 CAGGGGGCGAATGTGCTCTCAGG + Exonic
922722103 1:227904448-227904470 CGGGTGGCGGGCATGTTCCCTGG + Intergenic
923793691 1:237133258-237133280 CAGGTGGAGAGCGAGGTCACTGG + Intronic
1063013029 10:2044006-2044028 CAGGTGTCCAAGGTGTTCTCTGG - Intergenic
1076049057 10:127318260-127318282 CAGGTGTGGAGCCTGTTTTCTGG + Intronic
1077412336 11:2409471-2409493 GTGGTGACGAGCTTGTTCTCTGG - Intronic
1080888740 11:36390141-36390163 GAGGTGGGGAGGGTGCTCTCTGG + Intronic
1083895652 11:65618553-65618575 CAGGTGGAGAGTGTCTTCGCAGG - Exonic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1084554783 11:69869183-69869205 CAGGTGGGGAGCATGTCCTGGGG - Intergenic
1086610113 11:88745431-88745453 CAGGTGGATAGCTTGATCTCAGG - Intronic
1087562945 11:99814864-99814886 CATGTGGCTAGCGTGGCCTCAGG + Intronic
1091753629 12:3038037-3038059 CAGGTGATGATCATGTTCTCGGG - Exonic
1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG + Exonic
1101127218 12:101648759-101648781 CAGGTGGGGAATGTTTTCTCAGG + Intronic
1108062919 13:46551659-46551681 CAGGTGGCGCGTGTCTCCTCCGG + Intergenic
1109263885 13:60174476-60174498 CAGGGGCAGAGCCTGTTCTCAGG - Intergenic
1130706054 15:86233910-86233932 AAGGTGGCCAGGGTGTTCCCAGG + Intronic
1132648592 16:1010318-1010340 CAGGTGGGGAGCCTGGTGTCTGG + Intergenic
1138993330 16:62418049-62418071 CAGGTGGTGGGCCTGTCCTCAGG + Intergenic
1142675603 17:1511466-1511488 CGGGTGGGGAGCGTGTACTGGGG + Intronic
1151481373 17:74371830-74371852 CAGGTGGTCATCGTGTTCGCGGG + Exonic
1154254222 18:12768638-12768660 CTGGTGGTGAGCATGTTTTCTGG - Intergenic
1157548973 18:48567668-48567690 GAAGTGGGGAACGTGTTCTCAGG + Intronic
1160387485 18:78505322-78505344 CAGGTGGATAACGTGTGCTCGGG + Intergenic
1162916218 19:13875905-13875927 CAGGAGGGGAGGGTGTGCTCAGG - Intronic
1167251044 19:48398546-48398568 AACGTGGCGCTCGTGTTCTCGGG + Exonic
926296091 2:11569832-11569854 GAGGTGGCGAGAGTGCTCTGTGG + Intronic
931483391 2:62666359-62666381 AAGGTGGTGAGGGTGCTCTCTGG + Intergenic
931825141 2:65992468-65992490 CAAATGGCAATCGTGTTCTCTGG - Intergenic
932029002 2:68164260-68164282 CAGGTGGATGGCGTGATCTCAGG + Intronic
932214737 2:69959309-69959331 CATCGGGCGAGCCTGTTCTCAGG - Intergenic
935271079 2:101435046-101435068 CTGGCGGCGAGCGGGTTCACAGG - Intronic
948567911 2:238898110-238898132 CAGCTGGCGAACGCGGTCTCAGG + Intronic
1170042420 20:12052621-12052643 CAGGTAGCCAGCGTGCTCTTGGG + Intergenic
1174611315 20:51800966-51800988 AAAGTGGCGACCGTCTTCTCGGG + Intronic
1181533400 22:23529846-23529868 CAGGTGGAGCTGGTGTTCTCAGG + Intergenic
953743442 3:45555863-45555885 CAGGTGGGGTGGGTGTTCCCTGG + Intronic
956755705 3:72383835-72383857 CAGGTGGCAGTGGTGTTCTCAGG - Intronic
968609450 4:1550418-1550440 CAGGTGGCGAGCGTGTTCTCAGG + Intergenic
969219573 4:5751207-5751229 CAGGTGAGGAGCTTGTGCTCAGG + Intronic
972815810 4:42643991-42644013 CAGGTGGCTACCGTGTCATCTGG + Intronic
990003420 5:50921410-50921432 CAGGCGATGAGCGTGTTCTCAGG - Intergenic
999701566 5:154233295-154233317 CAGGTGGGAAGCCTGTTCTAGGG + Intronic
1007101125 6:39247587-39247609 CATGTGGGGATCGTGTTCTGGGG - Intergenic
1011551004 6:88530991-88531013 CAAGTGGAGAGCCTGTGCTCAGG - Intergenic
1018769587 6:166959011-166959033 CCCGTGGCCAGCCTGTTCTCAGG + Intergenic
1018945279 6:168343578-168343600 CAGGTGTCCTGCGTGGTCTCCGG + Intergenic
1019052506 6:169193933-169193955 CAGGTGCTGAGAATGTTCTCTGG - Intergenic
1023232806 7:38051676-38051698 CAGGTGGGGAGTGTGTTCTTTGG + Intergenic
1024293869 7:47827436-47827458 CAGGTGGCGAGCTTGTTGTCGGG + Exonic
1036641850 8:10589799-10589821 CAAGAGGGGAACGTGTTCTCTGG + Intergenic
1036678681 8:10854764-10854786 CAGGAGTCACGCGTGTTCTCAGG + Intergenic
1038432357 8:27510459-27510481 CAGGTGCCAGGCCTGTTCTCAGG - Intronic
1057342411 9:94214487-94214509 CAGGTGGAGAGCCTGTTAGCAGG + Intergenic
1057951902 9:99375954-99375976 CAGGTGGCCAGCATCTTCTCTGG - Intergenic
1061118431 9:128628817-128628839 CAGGTGGCCAGGGTGTCCTACGG - Intronic
1062320309 9:135987690-135987712 CAGGTGGCAAGCGTGGTTGCAGG + Intergenic
1185769124 X:2751834-2751856 CAGGCGGCCAGTGTCTTCTCTGG + Intergenic
1186189808 X:7057349-7057371 CAGGGAGCCAGCGTGGTCTCTGG + Intronic
1186262995 X:7800902-7800924 CATGTGTTGAGTGTGTTCTCTGG + Intergenic
1199408770 X:147494581-147494603 CAGGTGGTGAGTGTGTGATCAGG - Intergenic