ID: 968610382

View in Genome Browser
Species Human (GRCh38)
Location 4:1554280-1554302
Sequence GGTCTGTCTCCCCATCACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968610363_968610382 30 Left 968610363 4:1554227-1554249 CCCTCACCCTCTGTCTGACCTGT No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610366_968610382 23 Left 968610366 4:1554234-1554256 CCTCTGTCTGACCTGTCTGACGG No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610375_968610382 -8 Left 968610375 4:1554265-1554287 CCTCACCAGCCCCCCGGTCTGTC No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610364_968610382 29 Left 968610364 4:1554228-1554250 CCTCACCCTCTGTCTGACCTGTC No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610372_968610382 -3 Left 968610372 4:1554260-1554282 CCCCTCCTCACCAGCCCCCCGGT No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610370_968610382 12 Left 968610370 4:1554245-1554267 CCTGTCTGACGGGGACCCCTCCT No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610373_968610382 -4 Left 968610373 4:1554261-1554283 CCCTCCTCACCAGCCCCCCGGTC No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610374_968610382 -5 Left 968610374 4:1554262-1554284 CCTCCTCACCAGCCCCCCGGTCT No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data
968610365_968610382 24 Left 968610365 4:1554233-1554255 CCCTCTGTCTGACCTGTCTGACG No data
Right 968610382 4:1554280-1554302 GGTCTGTCTCCCCATCACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968610382 Original CRISPR GGTCTGTCTCCCCATCACCT CGG Intergenic
No off target data available for this crispr