ID: 968611864

View in Genome Browser
Species Human (GRCh38)
Location 4:1560887-1560909
Sequence CTCGGCTGCCCGGGTCCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968611864_968611876 30 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611876 4:1560940-1560962 CATTTCCATGGTGCAGCCATGGG No data
968611864_968611870 -6 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611870 4:1560904-1560926 GCCGAGAGGCAGCATGAGGAGGG No data
968611864_968611873 0 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611873 4:1560910-1560932 AGGCAGCATGAGGAGGGATTGGG No data
968611864_968611872 -1 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611872 4:1560909-1560931 GAGGCAGCATGAGGAGGGATTGG No data
968611864_968611868 -10 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611868 4:1560900-1560922 GGCAGCCGAGAGGCAGCATGAGG No data
968611864_968611874 18 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611874 4:1560928-1560950 TTGGGTTCTGTGCATTTCCATGG No data
968611864_968611869 -7 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611869 4:1560903-1560925 AGCCGAGAGGCAGCATGAGGAGG No data
968611864_968611875 29 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611875 4:1560939-1560961 GCATTTCCATGGTGCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968611864 Original CRISPR CTCGGCTGCCCGGGTCCCCT CGG (reversed) Intergenic
No off target data available for this crispr