ID: 968611870

View in Genome Browser
Species Human (GRCh38)
Location 4:1560904-1560926
Sequence GCCGAGAGGCAGCATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968611864_968611870 -6 Left 968611864 4:1560887-1560909 CCGAGGGGACCCGGGCAGCCGAG No data
Right 968611870 4:1560904-1560926 GCCGAGAGGCAGCATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968611870 Original CRISPR GCCGAGAGGCAGCATGAGGA GGG Intergenic
No off target data available for this crispr