ID: 968611870 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:1560904-1560926 |
Sequence | GCCGAGAGGCAGCATGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
968611864_968611870 | -6 | Left | 968611864 | 4:1560887-1560909 | CCGAGGGGACCCGGGCAGCCGAG | No data | ||
Right | 968611870 | 4:1560904-1560926 | GCCGAGAGGCAGCATGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
968611870 | Original CRISPR | GCCGAGAGGCAGCATGAGGA GGG | Intergenic | ||
No off target data available for this crispr |