ID: 968613622

View in Genome Browser
Species Human (GRCh38)
Location 4:1567804-1567826
Sequence CCTTCCACCCATGTGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968613622_968613639 26 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613639 4:1567853-1567875 CCACACGTGCGACCAGGGGAAGG No data
968613622_968613635 21 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613635 4:1567848-1567870 GCCGTCCACACGTGCGACCAGGG No data
968613622_968613630 -10 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613630 4:1567817-1567839 GGGTGGAAGGTGCAAGGGGATGG No data
968613622_968613631 -9 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613631 4:1567818-1567840 GGTGGAAGGTGCAAGGGGATGGG No data
968613622_968613632 -8 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613632 4:1567819-1567841 GTGGAAGGTGCAAGGGGATGGGG No data
968613622_968613633 -7 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613633 4:1567820-1567842 TGGAAGGTGCAAGGGGATGGGGG No data
968613622_968613634 20 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613634 4:1567847-1567869 AGCCGTCCACACGTGCGACCAGG No data
968613622_968613640 27 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613640 4:1567854-1567876 CACACGTGCGACCAGGGGAAGGG No data
968613622_968613637 22 Left 968613622 4:1567804-1567826 CCCCTCCACACATGGGTGGAAGG No data
Right 968613637 4:1567849-1567871 CCGTCCACACGTGCGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968613622 Original CRISPR CCTTCCACCCATGTGTGGAG GGG (reversed) Intergenic
No off target data available for this crispr