ID: 968614233

View in Genome Browser
Species Human (GRCh38)
Location 4:1570167-1570189
Sequence CTGGGTAGGAAGAGGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968614225_968614233 4 Left 968614225 4:1570140-1570162 CCTGTGGGGCTGTGAGGGGGGTT No data
Right 968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG No data
968614216_968614233 28 Left 968614216 4:1570116-1570138 CCACAGAACTTTGGGTTCTGGAC No data
Right 968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968614233 Original CRISPR CTGGGTAGGAAGAGGGTGCA AGG Intergenic
No off target data available for this crispr