ID: 968614615

View in Genome Browser
Species Human (GRCh38)
Location 4:1571733-1571755
Sequence CCTTCCCCCTGTGCAGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968614615_968614625 8 Left 968614615 4:1571733-1571755 CCTGACCCTGCACAGGGGGAAGG No data
Right 968614625 4:1571764-1571786 AAGGGGTGCATCGTGCAAGGAGG No data
968614615_968614622 -10 Left 968614615 4:1571733-1571755 CCTGACCCTGCACAGGGGGAAGG No data
Right 968614622 4:1571746-1571768 AGGGGGAAGGGAGCGTGGAAGGG No data
968614615_968614626 11 Left 968614615 4:1571733-1571755 CCTGACCCTGCACAGGGGGAAGG No data
Right 968614626 4:1571767-1571789 GGGTGCATCGTGCAAGGAGGTGG No data
968614615_968614623 -9 Left 968614615 4:1571733-1571755 CCTGACCCTGCACAGGGGGAAGG No data
Right 968614623 4:1571747-1571769 GGGGGAAGGGAGCGTGGAAGGGG No data
968614615_968614628 27 Left 968614615 4:1571733-1571755 CCTGACCCTGCACAGGGGGAAGG No data
Right 968614628 4:1571783-1571805 GAGGTGGAAAGCTGCTCTCTGGG No data
968614615_968614627 26 Left 968614615 4:1571733-1571755 CCTGACCCTGCACAGGGGGAAGG No data
Right 968614627 4:1571782-1571804 GGAGGTGGAAAGCTGCTCTCTGG No data
968614615_968614624 5 Left 968614615 4:1571733-1571755 CCTGACCCTGCACAGGGGGAAGG No data
Right 968614624 4:1571761-1571783 TGGAAGGGGTGCATCGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968614615 Original CRISPR CCTTCCCCCTGTGCAGGGTC AGG (reversed) Intergenic
No off target data available for this crispr