ID: 968616268

View in Genome Browser
Species Human (GRCh38)
Location 4:1579124-1579146
Sequence GCAGCCGCCTCCGGGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968616268_968616275 -1 Left 968616268 4:1579124-1579146 CCGACCAGCCCGGAGGCGGCTGC No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616268_968616285 29 Left 968616268 4:1579124-1579146 CCGACCAGCCCGGAGGCGGCTGC No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968616268 Original CRISPR GCAGCCGCCTCCGGGCTGGT CGG (reversed) Intergenic