ID: 968616269

View in Genome Browser
Species Human (GRCh38)
Location 4:1579128-1579150
Sequence AGGCGCAGCCGCCTCCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968616269_968616285 25 Left 968616269 4:1579128-1579150 CCAGCCCGGAGGCGGCTGCGCCT No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616269_968616275 -5 Left 968616269 4:1579128-1579150 CCAGCCCGGAGGCGGCTGCGCCT No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968616269 Original CRISPR AGGCGCAGCCGCCTCCGGGC TGG (reversed) Intergenic