ID: 968616270

View in Genome Browser
Species Human (GRCh38)
Location 4:1579132-1579154
Sequence CTGGAGGCGCAGCCGCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968616270_968616285 21 Left 968616270 4:1579132-1579154 CCCGGAGGCGGCTGCGCCTCCAG No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616270_968616275 -9 Left 968616270 4:1579132-1579154 CCCGGAGGCGGCTGCGCCTCCAG No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968616270 Original CRISPR CTGGAGGCGCAGCCGCCTCC GGG (reversed) Intergenic
No off target data available for this crispr