ID: 968616275

View in Genome Browser
Species Human (GRCh38)
Location 4:1579146-1579168
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968616270_968616275 -9 Left 968616270 4:1579132-1579154 CCCGGAGGCGGCTGCGCCTCCAG No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616261_968616275 16 Left 968616261 4:1579107-1579129 CCCGAGCGCTCCCGAATCCGACC No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616271_968616275 -10 Left 968616271 4:1579133-1579155 CCGGAGGCGGCTGCGCCTCCAGG No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616266_968616275 5 Left 968616266 4:1579118-1579140 CCGAATCCGACCAGCCCGGAGGC No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616259_968616275 20 Left 968616259 4:1579103-1579125 CCCTCCCGAGCGCTCCCGAATCC No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616264_968616275 6 Left 968616264 4:1579117-1579139 CCCGAATCCGACCAGCCCGGAGG No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616258_968616275 21 Left 968616258 4:1579102-1579124 CCCCTCCCGAGCGCTCCCGAATC No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616269_968616275 -5 Left 968616269 4:1579128-1579150 CCAGCCCGGAGGCGGCTGCGCCT No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616260_968616275 19 Left 968616260 4:1579104-1579126 CCTCCCGAGCGCTCCCGAATCCG No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616262_968616275 15 Left 968616262 4:1579108-1579130 CCGAGCGCTCCCGAATCCGACCA No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data
968616268_968616275 -1 Left 968616268 4:1579124-1579146 CCGACCAGCCCGGAGGCGGCTGC No data
Right 968616275 4:1579146-1579168 CGCCTCCAGGGGCTCCCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type