ID: 968616278

View in Genome Browser
Species Human (GRCh38)
Location 4:1579160-1579182
Sequence AGGGGGGGCAGGGGCCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968616278_968616285 -7 Left 968616278 4:1579160-1579182 CCCGTCAGGCCCCTGCCCCCCCT No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616278_968616303 29 Left 968616278 4:1579160-1579182 CCCGTCAGGCCCCTGCCCCCCCT No data
Right 968616303 4:1579212-1579234 CTAGCCGCCATCCCCGCCCGAGG No data
968616278_968616304 30 Left 968616278 4:1579160-1579182 CCCGTCAGGCCCCTGCCCCCCCT No data
Right 968616304 4:1579213-1579235 TAGCCGCCATCCCCGCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968616278 Original CRISPR AGGGGGGGCAGGGGCCTGAC GGG (reversed) Intergenic