ID: 968616285

View in Genome Browser
Species Human (GRCh38)
Location 4:1579176-1579198
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968616279_968616285 -8 Left 968616279 4:1579161-1579183 CCGTCAGGCCCCTGCCCCCCCTG No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616276_968616285 5 Left 968616276 4:1579148-1579170 CCTCCAGGGGCTCCCGTCAGGCC No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616277_968616285 2 Left 968616277 4:1579151-1579173 CCAGGGGCTCCCGTCAGGCCCCT No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616270_968616285 21 Left 968616270 4:1579132-1579154 CCCGGAGGCGGCTGCGCCTCCAG No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616268_968616285 29 Left 968616268 4:1579124-1579146 CCGACCAGCCCGGAGGCGGCTGC No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616278_968616285 -7 Left 968616278 4:1579160-1579182 CCCGTCAGGCCCCTGCCCCCCCT No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616269_968616285 25 Left 968616269 4:1579128-1579150 CCAGCCCGGAGGCGGCTGCGCCT No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data
968616271_968616285 20 Left 968616271 4:1579133-1579155 CCGGAGGCGGCTGCGCCTCCAGG No data
Right 968616285 4:1579176-1579198 CCCCCCTGCCCTCCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr