ID: 968621157

View in Genome Browser
Species Human (GRCh38)
Location 4:1604055-1604077
Sequence ACACTGGGGCCATCATCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968621142_968621157 8 Left 968621142 4:1604024-1604046 CCCGGCTGCCCTCAGAGACCCTG No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621150_968621157 -10 Left 968621150 4:1604042-1604064 CCCTGCCCAGGCCACACTGGGGC No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621143_968621157 7 Left 968621143 4:1604025-1604047 CCGGCTGCCCTCAGAGACCCTGC No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621145_968621157 0 Left 968621145 4:1604032-1604054 CCCTCAGAGACCCTGCCCAGGCC No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621140_968621157 13 Left 968621140 4:1604019-1604041 CCCTGCCCGGCTGCCCTCAGAGA No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621137_968621157 26 Left 968621137 4:1604006-1604028 CCTGCCAGAAAAGCCCTGCCCGG No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621136_968621157 30 Left 968621136 4:1604002-1604024 CCAGCCTGCCAGAAAAGCCCTGC No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621139_968621157 22 Left 968621139 4:1604010-1604032 CCAGAAAAGCCCTGCCCGGCTGC No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621146_968621157 -1 Left 968621146 4:1604033-1604055 CCTCAGAGACCCTGCCCAGGCCA No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data
968621141_968621157 12 Left 968621141 4:1604020-1604042 CCTGCCCGGCTGCCCTCAGAGAC No data
Right 968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968621157 Original CRISPR ACACTGGGGCCATCATCGCG GGG Intergenic
No off target data available for this crispr