ID: 968624138

View in Genome Browser
Species Human (GRCh38)
Location 4:1618884-1618906
Sequence GATAAGCCCTGAGCCCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968624138 Original CRISPR GATAAGCCCTGAGCCCTCGG GGG (reversed) Intronic
901051936 1:6429704-6429726 GAGAAGCCGTGATCCCTCCGTGG + Intronic
902509091 1:16955848-16955870 GCTAAGCCCTGAGCCCTGCAGGG - Intronic
903748207 1:25602710-25602732 GATAATCACTGAGCCATTGGGGG + Intergenic
916370921 1:164093168-164093190 GACAAGCCCAGAGGCCTGGGAGG - Intergenic
917267662 1:173238897-173238919 GATGAGCCCTAAGACCTCAGGGG + Intergenic
917565292 1:176206918-176206940 GACAAGCCCCGGGTCCTCGGCGG - Exonic
919797494 1:201330091-201330113 GAGAAGCCCTCAGGCCTCGCTGG + Exonic
919940902 1:202285353-202285375 GAAGAACCCTGAGCCCTGGGAGG - Intronic
1064162817 10:12960438-12960460 GATAAGCCTTGAACCCAGGGTGG - Intronic
1067037690 10:42932200-42932222 GATAAGGCCTGGGCCCTGCGTGG + Intergenic
1067233353 10:44426984-44427006 GATCAGCCCTGAGCACCCAGTGG + Intergenic
1070494870 10:77012380-77012402 AATGAGCCCTGGGCCCTTGGTGG + Intronic
1074114112 10:110443009-110443031 TCTCAGCCCTGAGCCCTGGGCGG + Intergenic
1076063898 10:127433490-127433512 AATAAACCCAGAGCCCTGGGTGG - Intronic
1077779913 11:5316225-5316247 CAAAAGCCATGAGCCCTCTGTGG + Intronic
1081246378 11:40771410-40771432 CATAGGCCCAGAGCCCTAGGAGG - Intronic
1082807335 11:57459438-57459460 GATAGGCTCGGGGCCCTCGGGGG - Intergenic
1083796528 11:65020105-65020127 GATGATCCCTGAGCTCTCCGTGG - Intronic
1085044823 11:73346735-73346757 GAACAGCCCGGAGCCCTGGGCGG + Intronic
1085411764 11:76295530-76295552 TATAAGCCCTGGGTCTTCGGGGG + Intergenic
1086402561 11:86472749-86472771 TATAGGCACTGAGTCCTCGGAGG + Intronic
1087259075 11:95990586-95990608 GAGAAGCCTTGAGCCCACTGAGG - Intronic
1088484756 11:110329708-110329730 CATAAGCTCTGAGGCCTAGGAGG - Intergenic
1089537390 11:119169062-119169084 GATAACCCCTGCGCCCTGGCTGG + Exonic
1091218946 11:133919486-133919508 GGCAAGCCCTGAGCTCTCGGCGG - Intronic
1092524936 12:9304033-9304055 GATCAGCTCTGGGCCCTCTGAGG - Intergenic
1092542331 12:9427785-9427807 GATCAGCTCTGGGCCCTCTGAGG + Intergenic
1094510682 12:31094648-31094670 GATCAGCTCTGGGCCCTCTGAGG - Intronic
1100357822 12:93848699-93848721 GCTAAGCCCTGAACACTAGGAGG - Intronic
1101745882 12:107541187-107541209 GATGAGTCCTAAGCCTTCGGAGG + Intronic
1102051388 12:109864544-109864566 CATAAGCCCAGAGCCTTGGGTGG - Intronic
1103558292 12:121779001-121779023 GATAGGCCCAGCCCCCTCGGTGG + Exonic
1104607049 12:130197760-130197782 GGACAGCCCTGAGCCCTCTGCGG - Intergenic
1104748358 12:131223570-131223592 AATAAACCCAGAGCCCTAGGAGG + Intergenic
1105224983 13:18423912-18423934 GATCTGCCCTGAGCCCTATGAGG - Intergenic
1109130214 13:58575088-58575110 CATAGGCCCTGAGGCCTAGGAGG - Intergenic
1112825080 13:103382576-103382598 CACAAGCCCTGAGGCCTAGGAGG - Intergenic
1114009088 14:18348279-18348301 GATCTGCCCTGAGCCCTGTGAGG - Intergenic
1114577162 14:23725728-23725750 GATGAGGACTGAGCCCTCGCAGG - Intergenic
1122906750 14:104805162-104805184 CATTAGCCCTGAGCCCTCCCTGG + Intergenic
1123392285 15:19888882-19888904 GATCTGCCCTGAGCCCTGTGAGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1127818027 15:62629615-62629637 GCTAAGCCATGAGCCCTTGGAGG + Intronic
1132272515 15:100538670-100538692 TATAAGCCCAGAGGCCTAGGAGG - Intronic
1132630508 16:915033-915055 TACAAGCCCTCAGGCCTCGGGGG - Intronic
1133029075 16:3001166-3001188 GCTGAGCCCTGGGCCCTCCGGGG + Intergenic
1137727599 16:50667571-50667593 GATAAGGCCTGAGACATCGTAGG + Intronic
1139358429 16:66381349-66381371 GATATGCTCTGAGCTCTAGGAGG - Intronic
1141402538 16:83762961-83762983 CATATGCCCTGAGCCTTAGGGGG - Intronic
1142150680 16:88511284-88511306 GACAAGCACTGAGCTCACGGTGG + Intronic
1145932744 17:28697733-28697755 GGTAAGCCCAGGGCCCTCTGAGG + Exonic
1148458163 17:47821902-47821924 GCTCAGCCCTGAGTCCTCCGGGG - Intergenic
1148817180 17:50337368-50337390 GATAAGCCCTGGGTCTTAGGGGG + Intergenic
1150739045 17:67764891-67764913 GAAAAGCCCTGAGCCCTGTGAGG + Intergenic
1151464176 17:74273951-74273973 GGGAAGCCCTGATCCCTGGGTGG - Intergenic
1152093068 17:78257600-78257622 GAGAAGCCCAAAGCCCTCTGTGG + Intergenic
1152337221 17:79705821-79705843 CCTGAGCCCTGAGCCCTCAGCGG + Intergenic
1153592010 18:6683784-6683806 GATGAGCCCTGGGCCAGCGGAGG + Intergenic
1154528380 18:15315610-15315632 GATCTGCCCTGAGCCCTATGAGG + Intergenic
1158183644 18:54746365-54746387 GGTAAGACCTGAGCCCTCAGTGG + Intronic
1160223071 18:76991366-76991388 GAAAAGCCATGAGCGCCCGGGGG + Intronic
1160617952 18:80148151-80148173 GCAAAGCCATGAGCCCTCCGAGG + Exonic
1162865660 19:13544682-13544704 GCTAAGCCCTGAACTCTCAGTGG - Intronic
1163251493 19:16128695-16128717 GGCAAGGCCTGAGCCCTGGGTGG - Intronic
1163254062 19:16144216-16144238 CCTAAGCCCTGATCCCTAGGAGG + Intronic
1166431107 19:42728867-42728889 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166444110 19:42844108-42844130 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166451548 19:42906666-42906688 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166463791 19:43014860-43014882 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166469943 19:43071444-43071466 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166481078 19:43174959-43174981 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166490660 19:43257946-43257968 TATCAGCCCTGAGCCCTATGTGG - Intronic
1167450057 19:49562047-49562069 GAGAAGCCCTGAACCCACAGAGG + Intronic
932445648 2:71779415-71779437 GAGAGGCCCTGAACCCTGGGTGG + Intergenic
935425837 2:102917389-102917411 GACAGGCCCAGAGCCCTAGGAGG - Intergenic
935720001 2:105971684-105971706 TACAACCCCTGAGCCCTAGGTGG + Intergenic
936531283 2:113278416-113278438 AGGAAGCCCCGAGCCCTCGGCGG - Exonic
936969597 2:118164559-118164581 GACAGGCCCTGAGACCTAGGAGG + Intergenic
938527486 2:132147074-132147096 GATCTGCCCTGAGCCCTATGAGG + Intergenic
939667597 2:144969784-144969806 CATAGGCCCAGAGCCCTAGGAGG - Intergenic
945265386 2:207886231-207886253 GATGAGCCCCAAGCCCACGGAGG + Intronic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
1174573779 20:51523247-51523269 GACCAGCCCTGACCCCTCGCCGG - Exonic
1176769034 21:13052930-13052952 GATCTGCCCTGAGCCCTATGAGG - Intergenic
1180077776 21:45471955-45471977 GAGAAGCTCTGAGCCCGTGGTGG - Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180433587 22:15279089-15279111 GATCTGCCCTGAGCCCTGTGAGG - Intergenic
1180516145 22:16146998-16147020 GATCTGCCCTGAGCCCTATGAGG - Intergenic
1184551952 22:45209295-45209317 CAAAAGCCCTGAGCGCTCGGTGG - Intronic
1184776809 22:46627466-46627488 GCTAGGCCCTGGGCCCTGGGTGG + Intronic
951132849 3:19068926-19068948 CATAGGCCCTGAGGCCTAGGAGG + Intergenic
953178670 3:40576227-40576249 GATGAGACCTGAGCCCTGGCTGG + Intergenic
953385300 3:42502713-42502735 GGTCTGCCCTGAGCCCGCGGCGG - Exonic
953541599 3:43823907-43823929 GACAAGCCCTGAGCCCATGATGG - Intergenic
954001995 3:47565181-47565203 GATTAAACCTGAGCCCTCGAGGG + Intronic
968582144 4:1400174-1400196 GATGGGTCCTGAGCCCTAGGAGG + Intergenic
968605460 4:1533087-1533109 GACGAGCCCTGAGCCCTGGGTGG + Intergenic
968624138 4:1618884-1618906 GATAAGCCCTGAGCCCTCGGGGG - Intronic
975575272 4:75856428-75856450 GATAAGCCCCTTGCCCTTGGTGG + Intergenic
975861084 4:78677806-78677828 GAGAAGCCCTGAGCACACTGTGG + Intergenic
976635943 4:87286623-87286645 CATAAGCCCAGAGGCCTGGGAGG + Intergenic
979966843 4:127086420-127086442 CATAGGCCCTGAGGCCTAGGAGG + Intergenic
982215538 4:153079901-153079923 AATAAGCCCTGAGCACTTTGTGG + Intergenic
988040983 5:25888482-25888504 GATAAGCCAGGAGGCCTAGGAGG - Intergenic
997510065 5:134447967-134447989 GAGAAGCTCTGAGACCTCAGGGG - Intergenic
999320912 5:150614482-150614504 CATAAGCCCTGCTCCCTCTGAGG - Intronic
999643710 5:153697783-153697805 GTTAAGCCCTTATCCCTCAGAGG + Intronic
1002523954 5:179805771-179805793 AGTAGGGCCTGAGCCCTCGGAGG - Intronic
1008337531 6:50324917-50324939 GATAGGCCCAGAGGCCTAGGAGG - Intergenic
1008667893 6:53734929-53734951 GATAAGCCCTGAATCCACGTGGG + Intergenic
1009732135 6:67622183-67622205 CACATGCCCTGAGGCCTCGGAGG + Intergenic
1009791251 6:68403901-68403923 TATACGCCCTGAGGCCTAGGAGG - Intergenic
1011650299 6:89499992-89500014 TATAAGCCCAGATGCCTCGGAGG - Intronic
1012118475 6:95334276-95334298 CATAAGCCTTGAGGCCTAGGAGG - Intergenic
1012453115 6:99374759-99374781 GATAAATCCTGAGTCCTCGTAGG + Intronic
1013605895 6:111747682-111747704 GAAAAGCTCTCAGCCCTGGGTGG + Intronic
1019962691 7:4474020-4474042 GCTAAGCCCTGACCCATCAGTGG + Intergenic
1023840850 7:44096726-44096748 GATAGGCCCTCAGCCCTCCTGGG - Intergenic
1024644448 7:51359439-51359461 GATAAGCCCTTTGCCTTTGGAGG - Intergenic
1024647516 7:51382649-51382671 GAGGAGCCCTGGGCCCTCAGGGG + Intergenic
1024919387 7:54542215-54542237 GACGAGCCCTGCGCCCTCCGCGG + Intergenic
1027789420 7:82620483-82620505 CATAAGCCCAGAGCTCTAGGAGG + Intergenic
1034846872 7:154454542-154454564 GGAAAGCCATGAGCCCTCGGGGG + Intronic
1042039253 8:64575746-64575768 GACAAACCCTGAGCCCCGGGAGG - Intergenic
1043640475 8:82443659-82443681 GAGAAGCCCTGAGCACCCAGGGG + Intergenic
1045754614 8:105528125-105528147 GAGAAGCCCTGAGCCCAGGTGGG + Intronic
1049488563 8:142879075-142879097 GATGAGCCTGGAGCCCTGGGTGG - Exonic
1053706168 9:40754347-40754369 GATCTGCCCTGAGCCCTATGAGG + Intergenic
1054416244 9:64877952-64877974 GATCTGCCCTGAGCCCTATGAGG + Intergenic
1057233255 9:93338355-93338377 CACAAGCCCTGAGGCCTAGGAGG + Intronic
1059124848 9:111674678-111674700 GAAAAGCCCTGAAACCTCAGTGG - Intergenic
1060011994 9:120051839-120051861 GAGAAGTCCTGAGACCTCAGTGG - Intergenic
1061379376 9:130244872-130244894 CATAAGCCCTGAGACCCCCGAGG + Intergenic
1062165628 9:135105963-135105985 AAGCCGCCCTGAGCCCTCGGGGG + Intronic
1189594419 X:42548758-42548780 CACAAGCCCTGAGGCCTAGGAGG - Intergenic
1199083667 X:143605737-143605759 TATAAGCCCAGAGGCCTAGGAGG + Intergenic
1201486413 Y:14499381-14499403 GATGAGACCTGAGCCCTGGCTGG - Intergenic