ID: 968624629

View in Genome Browser
Species Human (GRCh38)
Location 4:1621602-1621624
Sequence GAATCAGGATTAGCTCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968624622_968624629 7 Left 968624622 4:1621572-1621594 CCTCCACAGCGGGGAGCGAAGAT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 82
968624620_968624629 12 Left 968624620 4:1621567-1621589 CCCAGCCTCCACAGCGGGGAGCG 0: 1
1: 0
2: 0
3: 10
4: 190
Right 968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 82
968624615_968624629 18 Left 968624615 4:1621561-1621583 CCGCCACCCAGCCTCCACAGCGG 0: 1
1: 0
2: 3
3: 50
4: 405
Right 968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 82
968624619_968624629 15 Left 968624619 4:1621564-1621586 CCACCCAGCCTCCACAGCGGGGA 0: 1
1: 0
2: 4
3: 53
4: 418
Right 968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 82
968624624_968624629 4 Left 968624624 4:1621575-1621597 CCACAGCGGGGAGCGAAGATGGT 0: 1
1: 0
2: 2
3: 5
4: 55
Right 968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 82
968624621_968624629 11 Left 968624621 4:1621568-1621590 CCAGCCTCCACAGCGGGGAGCGA 0: 1
1: 0
2: 0
3: 19
4: 228
Right 968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG 0: 1
1: 0
2: 1
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968624629 Original CRISPR GAATCAGGATTAGCTCCACT GGG Intronic
904805521 1:33128872-33128894 AAATCACAATTATCTCCACTTGG - Intergenic
906623356 1:47304103-47304125 GAATCAGGATTTGATTCCCTAGG + Intronic
916164257 1:161951078-161951100 CAATCAAGTTTAGCTCCCCTAGG - Intronic
918622417 1:186620754-186620776 GAAGCAGGATTCACACCACTAGG - Intergenic
919499491 1:198318092-198318114 GAATCAATTTTAGCTACACTTGG - Intronic
1068263811 10:54621113-54621135 GAATCAGCTTTATGTCCACTGGG - Intronic
1069122636 10:64586590-64586612 GCATTAGGAATATCTCCACTAGG - Intergenic
1074049401 10:109868389-109868411 GAAACAGGACTATCTCCACCTGG + Intronic
1088760204 11:112922346-112922368 GAATCAGGTTTTCCTCCTCTGGG - Intergenic
1088774472 11:113069129-113069151 CACTCAGGATCAGCTCCACAAGG - Intronic
1089583944 11:119498155-119498177 CAATCCTGATTAGCTCCACCGGG + Intergenic
1091738256 12:2940985-2941007 GAAGCAGGATGAGGTCCACCTGG - Exonic
1092182198 12:6453442-6453464 GAATCTGGACCAGGTCCACTGGG - Exonic
1094716481 12:33019299-33019321 GAACCAGGATGAGCACCCCTGGG - Intergenic
1095807745 12:46339150-46339172 GAATATGGATTAGGTCCATTTGG + Intergenic
1098549881 12:71751530-71751552 GAATCAAAATTAGTTTCACTAGG + Intergenic
1101517058 12:105446553-105446575 GACTCAGGATTGGCTCCAATTGG + Intergenic
1105067317 12:133211967-133211989 GAATCAGGATAACCTTCAATAGG + Intergenic
1106030496 13:25998060-25998082 GAATCTGGATTACCTCTACCCGG - Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1116140046 14:40981653-40981675 CATCCAGGATTAGCTCCAGTGGG - Intergenic
1116996382 14:51329279-51329301 GAAAAAGGATTTGATCCACTTGG - Intergenic
1121876379 14:97457041-97457063 GAAGGAGGATCAGCTCCACCTGG - Intergenic
1125038080 15:35150060-35150082 GAATGAGGATCTGGTCCACTGGG + Intergenic
1129786653 15:78314312-78314334 GCCTCAGGATTAGATGCACTCGG + Intergenic
1135961181 16:26995822-26995844 GAGGCAGGATTAGCCCCACCTGG + Intergenic
1137382145 16:48009438-48009460 GGCTCAGGATTTGCTTCACTGGG - Intergenic
1142137173 16:88456779-88456801 GAATCAGGAATAGGTCCCCAGGG + Intronic
1142565136 17:835428-835450 GAGACAAGATTAGCTCAACTTGG + Intronic
1151877585 17:76876004-76876026 GAATCAGGGTCAGCTCTCCTGGG - Intronic
1152333387 17:79686239-79686261 GAATCTGGATTCTATCCACTGGG + Intergenic
1157174102 18:45435227-45435249 GAATCAGCTTCATCTCCACTTGG - Intronic
1158432473 18:57401691-57401713 CAAACAGGATTAGCTCCAAGAGG + Intergenic
1164859894 19:31554654-31554676 GAATCAGCATAAGCCCCACAGGG + Intergenic
1168083831 19:54030227-54030249 GAAGCAGGAGAAGCTCCACGTGG + Intergenic
926805169 2:16702981-16703003 GAATCTCAATTGGCTCCACTAGG + Intergenic
937409589 2:121661768-121661790 GAATCTGGATTTGCGCTACTTGG + Intergenic
940806759 2:158195976-158195998 GAATCACAATTAGCTCCTCATGG + Intronic
942307038 2:174618786-174618808 GACTCAGGACTAGCCCCACAGGG - Intronic
943897288 2:193381312-193381334 GAATCATAATTATTTCCACTGGG + Intergenic
944927301 2:204478488-204478510 GCATCAGGATTTCCACCACTGGG - Intergenic
945362268 2:208906465-208906487 GCATCAGGAATAGCTTCCCTGGG - Intergenic
945950169 2:216031799-216031821 GAATCTGGATTAGTTTCAATGGG - Intronic
946090888 2:217222232-217222254 GAAAGACGATCAGCTCCACTTGG - Intergenic
948657526 2:239485876-239485898 GCATCAGGACCAGCACCACTGGG + Intergenic
1169907110 20:10615488-10615510 CAGTCAGGATGAGCTCTACTAGG - Intronic
1170602135 20:17849197-17849219 GAATCAGGAATGAGTCCACTGGG + Intergenic
1176897699 21:14402011-14402033 TAATATGGATTGGCTCCACTTGG - Intergenic
1177015389 21:15781623-15781645 GAGTCAAGAATAGCTCCACAGGG + Intronic
1177300517 21:19238814-19238836 GATTCTGGATTAGCTACACATGG - Intergenic
954517622 3:51192811-51192833 GAATCAGGAATGGCTTCCCTTGG - Intronic
956490121 3:69762409-69762431 GAATCAGGGTTAGAATCACTGGG - Intronic
957085842 3:75675665-75675687 GGATCAGCATTAACTGCACTTGG + Intergenic
958983151 3:100748451-100748473 GCATAAGGATTAGGCCCACTTGG - Exonic
960662038 3:120070971-120070993 TAATGAGGATTTGCTCCACTGGG - Intronic
965479700 3:169202870-169202892 GAATCAAAATCAGCTCCACCAGG + Intronic
968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG + Intronic
970531963 4:16994063-16994085 AAATCAGGATGTGTTCCACTGGG - Intergenic
970852272 4:20616330-20616352 GAGTCAGGGTTAGGTCCACCAGG - Intronic
970891367 4:21048825-21048847 GACTCAGGATAGGCCCCACTAGG - Intronic
972038633 4:34559888-34559910 GAATCAGGAGCAGCTTAACTGGG + Intergenic
977272369 4:94932804-94932826 GTATCAGGATTTGCTGGACTTGG + Intronic
977510293 4:97953559-97953581 GAATCAGGAATGGCTTCCCTTGG + Intronic
980926633 4:139144360-139144382 GAATCAGGAATAGCTTCCCTTGG - Intronic
981600854 4:146487029-146487051 GGAACAGGATTACCTGCACTGGG - Intronic
983059170 4:163136064-163136086 GAATCAGGTTTATGCCCACTTGG - Intronic
986325828 5:6673266-6673288 GAATCAGAAATAGCTCCATCAGG + Intergenic
990823121 5:59865397-59865419 TAATCAGTTTTAGCTCAACTGGG - Intronic
995186786 5:109280565-109280587 GAATCAGGAATGGCTTCCCTTGG - Intergenic
996398069 5:123032988-123033010 GAATCAGGATTAATTCCACAGGG - Intronic
997030011 5:130116607-130116629 GAATCAGGAATCGCTCCACTTGG - Intronic
997733399 5:136196444-136196466 GAAACAGAAATAGCTCCACCAGG - Intergenic
998903957 5:146883543-146883565 GAATCAGGATTATCTTCTCTTGG + Intronic
1000237467 5:159376043-159376065 TAATCAGGAATAGCTTCCCTGGG - Intergenic
1012383131 6:98644192-98644214 GAACCAGGATTTCCTCCACTGGG + Intergenic
1012781551 6:103564990-103565012 TAATCAGCATTACCTCCAGTGGG + Intergenic
1014945633 6:127494035-127494057 GAATCAGAATTATCTTCACAGGG + Intronic
1015826829 6:137322496-137322518 GAATCAGGCTTTGCTCCTCTGGG + Intergenic
1016847028 6:148578702-148578724 GACTCAGGATTAGGTCCACATGG - Intergenic
1018297355 6:162363183-162363205 GAAAGAGGGTTAGCTTCACTTGG + Intronic
1023793391 7:43771386-43771408 GTTTCAGGATTAGCTGCAGTGGG - Intronic
1023993871 7:45146761-45146783 GGCTCAGGCTGAGCTCCACTGGG + Intergenic
1026466148 7:70656485-70656507 ATTTCAGGATTAGCTCCATTTGG - Intronic
1037729359 8:21510841-21510863 GAATCAAGAGAAGCTGCACTTGG + Intergenic
1044059795 8:87621994-87622016 GAATCAGGCTCAGCCCCTCTTGG - Intergenic
1044151141 8:88775986-88776008 GAATGAAGATTATCTCCAGTGGG - Intergenic
1045822894 8:106362004-106362026 GAATCAGGATAGGATACACTTGG + Intronic
1047691633 8:127360757-127360779 GAATCAGGCAGAACTCCACTTGG - Intergenic
1047939925 8:129819781-129819803 GAATCAGGATGATCTCCAGCTGG - Intergenic
1048434685 8:134405212-134405234 GTATCAGGATTAACTTCACTGGG - Intergenic
1057340725 9:94198843-94198865 GAATCAGGAGTGGCTTCCCTCGG + Intergenic
1057703707 9:97382980-97383002 GAATCAGGAAGATCTCAACTTGG + Intergenic
1198928937 X:141831312-141831334 GAATCAGATTTAGCTCCTCCTGG - Intergenic