ID: 968625919

View in Genome Browser
Species Human (GRCh38)
Location 4:1626650-1626672
Sequence GGCCATGCCCTGAGCCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 2, 1: 1, 2: 0, 3: 30, 4: 413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968625911_968625919 4 Left 968625911 4:1626623-1626645 CCCGGGACAGTGTAAACTCTCAG 0: 1
1: 2
2: 2
3: 28
4: 276
Right 968625919 4:1626650-1626672 GGCCATGCCCTGAGCCCGGGGGG 0: 2
1: 1
2: 0
3: 30
4: 413
968625912_968625919 3 Left 968625912 4:1626624-1626646 CCGGGACAGTGTAAACTCTCAGC 0: 1
1: 2
2: 1
3: 8
4: 150
Right 968625919 4:1626650-1626672 GGCCATGCCCTGAGCCCGGGGGG 0: 2
1: 1
2: 0
3: 30
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968625919 Original CRISPR GGCCATGCCCTGAGCCCGGG GGG Intronic
900120266 1:1045843-1045865 GGCCGTGCCCTGGGCCCCGCGGG + Exonic
900213295 1:1467885-1467907 TGCCAAGCCCTGTGCCCAGGAGG + Intronic
900218519 1:1494997-1495019 TGCCAAGCCCTGTGCCCAGGAGG + Intronic
900220856 1:1508704-1508726 TGCCAAGCCCTGTGCCCAGGAGG + Intergenic
900287448 1:1908519-1908541 GGGCAGGCCCTGGGCTCGGGCGG - Intergenic
900359187 1:2279661-2279683 GGCCACGCCCAGTGCCTGGGTGG - Intronic
900396338 1:2454655-2454677 GGCCAGGACCTGAGCCCCAGTGG + Intronic
900462505 1:2808470-2808492 GGCCATGCCCAGAGCCTGCAGGG + Intergenic
900484500 1:2915022-2915044 GGCCAGCCCCTGAGCCCTGCAGG + Intergenic
900512257 1:3066342-3066364 GGCCAGGCCCTGCCCCCGCGTGG - Intergenic
900651552 1:3732477-3732499 GGCCCTGCCCTGAGGCTGGGAGG + Intronic
901250193 1:7771786-7771808 GGCCCTGTCCTGAGCCCCTGTGG + Intronic
902251026 1:15154163-15154185 GGCCAGGCGCGGTGCCCGGGAGG - Intronic
902317434 1:15633009-15633031 GGGGATGGCCTGAGCCCAGGAGG - Intronic
902373465 1:16019131-16019153 GACCTTGCCCTGGGCCAGGGTGG + Intronic
902377503 1:16036731-16036753 GGCCATGGCCCGAGGCCGCGTGG - Intergenic
902382677 1:16059989-16060011 GGCCATGGCCCGAGGCCGCGTGG - Exonic
902515555 1:16987705-16987727 GGCCATGCCCAGAGCAGGGGAGG + Intronic
902765801 1:18614203-18614225 GGCCATGCCCTGGGCCAGAGTGG + Intergenic
902786084 1:18733604-18733626 CCCCATGCCCTCAGCCCTGGGGG - Intronic
904292755 1:29498295-29498317 GGCGATGCCCAGAGCCTGGCAGG - Intergenic
904322947 1:29708447-29708469 GCCCAGGCCCTGAACCCTGGTGG - Intergenic
904788795 1:33002346-33002368 GGGCATTGCCTGAACCCGGGAGG - Intergenic
904944521 1:34189605-34189627 GGCCTTGGCCTGAGCCAGGGTGG + Intronic
906044425 1:42817086-42817108 GGCCGTCCCCTGGGGCCGGGCGG - Intronic
906703729 1:47879013-47879035 GACAATCACCTGAGCCCGGGAGG + Intronic
908688705 1:66752840-66752862 GGTCATCCCCTGACCCGGGGCGG + Intronic
910547366 1:88433239-88433261 GGACCTGCCCTGAGCCAGAGAGG + Intergenic
912984266 1:114411127-114411149 GGGCATGGCTTGAGCCTGGGAGG - Intronic
914846215 1:151284897-151284919 GAGGATCCCCTGAGCCCGGGAGG - Intronic
915425332 1:155821174-155821196 GACAATGGCCTGAACCCGGGAGG + Intronic
915541574 1:156570434-156570456 GGCCTAGACCTGAGCCCAGGAGG + Intronic
917226385 1:172788384-172788406 GGACATTCCCTGAGCCAGAGGGG - Intergenic
917445993 1:175106253-175106275 GGCCATACCCTGAGGGAGGGAGG + Intronic
919861682 1:201742872-201742894 GCCCCTGCCCTGAGCTTGGGAGG + Intronic
921205730 1:212846979-212847001 GGGGATCACCTGAGCCCGGGAGG - Intronic
922730799 1:227947990-227948012 GGCCCCGCCCCGCGCCCGGGAGG + Intergenic
922803456 1:228374255-228374277 GGCCATGCTCTGGGGCCTGGAGG + Intronic
923171414 1:231421359-231421381 GGGGATGCGCTGAGCCCCGGCGG - Exonic
923825298 1:237493540-237493562 GACAATGGCCTGAACCCGGGAGG - Intronic
1062924994 10:1309645-1309667 TGCCAGGCCCTGAACCAGGGAGG - Intronic
1063113703 10:3057973-3057995 GGCCAAGCCCAGAGCCTAGGTGG - Intergenic
1063489339 10:6448496-6448518 GGCAATTGCCTGAACCCGGGAGG - Intronic
1064006779 10:11705147-11705169 GCTCCTGCCCTGAGCCCGGCGGG - Intergenic
1064712561 10:18141280-18141302 GGCCACGCTCCGAGCCGGGGTGG + Intronic
1065006655 10:21386770-21386792 GGTCCTGCCCTGTACCCGGGAGG + Intergenic
1065857372 10:29841441-29841463 GGAGATCTCCTGAGCCCGGGAGG - Intergenic
1067972763 10:50991551-50991573 CGAGATGCCCTGCGCCCGGGTGG - Intronic
1069478895 10:68762237-68762259 GACAATGGCCTGAACCCGGGAGG + Intronic
1069537939 10:69269231-69269253 GAGAATGCCTTGAGCCCGGGAGG - Intergenic
1069828098 10:71266450-71266472 GGCCGAGCCCTGAGCCAAGGCGG + Intronic
1069839958 10:71333578-71333600 GGCCATGCCCTGTGGCCTGGTGG - Intronic
1070968616 10:80545256-80545278 GGCCAGGTCCTGAGCACAGGAGG - Intronic
1071291884 10:84194682-84194704 GAGCATGCCCTGGGCCCGCGGGG - Exonic
1071527385 10:86366415-86366437 GGCCTCGCCCCGGGCCCGGGTGG - Exonic
1075709189 10:124521604-124521626 GGCCTTGTCCTGGGCCCAGGTGG + Intronic
1076651799 10:131994707-131994729 GGCCATGCCCTAAGGCAGGATGG + Intergenic
1077394909 11:2315986-2316008 GGCACTGCCCTGGGCCCGGCCGG - Intronic
1077476222 11:2791719-2791741 GGCCAGAACCCGAGCCCGGGAGG - Intronic
1077635989 11:3841355-3841377 GCCCCTGCCCTGAGCCCCGGGGG + Intergenic
1078663286 11:13304257-13304279 GGGCTGGCCCTGAGCCGGGGTGG + Intronic
1080146096 11:28985857-28985879 GGCCATCCCCTGAGTGAGGGAGG + Intergenic
1080387326 11:31817782-31817804 GGCCGGGGCCGGAGCCCGGGCGG + Intronic
1080771655 11:35347689-35347711 TGCCAGGCCCTGAGCCAGGCAGG + Intronic
1081591509 11:44426385-44426407 GGCCCTGCCCTGACCGAGGGTGG - Intergenic
1081734495 11:45393628-45393650 GGCCCTGCCCTCAGGCCTGGAGG + Intergenic
1081753666 11:45529765-45529787 GGTCAAGTCCTGAGCCAGGGTGG - Intergenic
1082952400 11:58831124-58831146 GCCCAGGTCCTGAGCCTGGGAGG - Intergenic
1083038299 11:59661172-59661194 GGGAATCACCTGAGCCCGGGAGG - Intronic
1083431458 11:62615556-62615578 GACCATGCCCTGGGCCTGGAGGG + Exonic
1084136168 11:67184006-67184028 GGCAATTCCTTGAGCCCTGGAGG + Intronic
1084162259 11:67356298-67356320 GGCCAAGCCCAGAGTCCTGGGGG + Intronic
1084648517 11:70474531-70474553 GGCCTTGGCCAGAGCCCGTGAGG - Intronic
1088494135 11:110416926-110416948 GGGAATGCCGTGAACCCGGGAGG - Intergenic
1088851928 11:113711783-113711805 TGCCATTCCCTGAGCTCCGGTGG + Intergenic
1089555888 11:119315850-119315872 GCCCTTGCCCTGACCCCTGGGGG - Intronic
1090065953 11:123503634-123503656 GAGCATGCCTTGAACCCGGGAGG - Intergenic
1091243397 11:134069623-134069645 GGCCGTGCCCACCGCCCGGGAGG - Intronic
1092274276 12:7047415-7047437 AGCGATGCCCTGAGCCAGCGTGG + Intronic
1092727142 12:11497669-11497691 AGCCTGGCCCTGAGCCCAGGGGG + Intronic
1095098002 12:38158230-38158252 GTCCCTGCGCTGGGCCCGGGGGG + Intergenic
1095194379 12:39296156-39296178 GAGAATGCCCTGAACCCGGGAGG - Intronic
1096535901 12:52274514-52274536 GGCCATACTCTGACCCCAGGTGG - Intronic
1101645759 12:106629568-106629590 AGCCATCACCTGAGCCTGGGAGG - Intronic
1101858043 12:108460539-108460561 GAGGATGACCTGAGCCCGGGAGG + Intergenic
1102766820 12:115440604-115440626 GTCCAGGCCCTGAGCCAGGGAGG + Intergenic
1102967220 12:117137398-117137420 GGAGATCACCTGAGCCCGGGAGG + Intergenic
1103340627 12:120219429-120219451 GGCCAAGGCCAGAGCCAGGGAGG - Intronic
1103415205 12:120738564-120738586 GGCAATGCCCAGGGCCTGGGAGG - Exonic
1104285686 12:127422518-127422540 GAGGATTCCCTGAGCCCGGGAGG + Intergenic
1104404885 12:128509006-128509028 GGCCCTGCCCTGGGCCAGGCAGG - Intronic
1104635452 12:130435602-130435624 GCCCAAGCCCTGAGCTTGGGAGG - Intronic
1104744255 12:131201253-131201275 GTCCATGGCCCGAGCCTGGGAGG + Intergenic
1104790124 12:131475970-131475992 GTCCATGGCCCGAGCCTGGGAGG - Intergenic
1104920878 12:132290135-132290157 GACCAAGCCCTGAGTCAGGGAGG - Intronic
1104926463 12:132316535-132316557 GGCCATTCCCTGAGCACAGGTGG - Intronic
1106345964 13:28877982-28878004 GCCCATGCCCTGAACTCAGGAGG - Intronic
1107645863 13:42493693-42493715 GGCGATGCCATGAGCCAGGGAGG - Intergenic
1108020724 13:46125209-46125231 GGTCCTGCCCTGATCCCTGGAGG + Intergenic
1110807257 13:79770740-79770762 GAACATGGCCTGAACCCGGGAGG + Intergenic
1111558954 13:89918942-89918964 GAGAATGCCCTGAACCCGGGAGG - Intergenic
1112570427 13:100588719-100588741 GGTGAGGCGCTGAGCCCGGGCGG - Intronic
1112778022 13:102866567-102866589 CGCCAGGCCCTGAGCACAGGGGG - Intronic
1113457032 13:110456724-110456746 GCCCATGCCCTGTGTCTGGGGGG + Intronic
1113468134 13:110526151-110526173 GGCCATGCCCTTAGGCCAAGAGG + Intronic
1113504560 13:110806348-110806370 GAAGATGCCCTGAGCCCAGGAGG - Intergenic
1113955504 13:114098261-114098283 GGCCATGCCCTCTACCCTGGGGG + Intronic
1114288181 14:21265686-21265708 GGGCACCCCTTGAGCCCGGGAGG + Intronic
1114490339 14:23096664-23096686 GAGCATCACCTGAGCCCGGGAGG - Intronic
1115779975 14:36758396-36758418 GGTCATGCCCTGGGCCCAGAGGG - Intronic
1116817928 14:49599961-49599983 GACCATGCCCGGAGGCCGGCCGG + Intronic
1118220891 14:63853515-63853537 GGCCGGGGCCTGGGCCCGGGAGG - Intronic
1119147043 14:72326795-72326817 GACAATGGCGTGAGCCCGGGAGG - Intronic
1122362226 14:101174284-101174306 AGCCATGTCCTGAGCCAGGCAGG - Intergenic
1122636088 14:103130319-103130341 GGCCTTGGCCTGGGCCTGGGAGG - Exonic
1122889333 14:104725160-104725182 GGCCCAGCCCTGGGCCCTGGGGG - Intronic
1122971845 14:105155416-105155438 AGCCGGGCCCTGAGCTCGGGAGG - Intronic
1125597767 15:40898559-40898581 GGAGATCACCTGAGCCCGGGAGG - Intronic
1125662057 15:41402310-41402332 GGCCAGGCCGTGAGTGCGGGAGG - Exonic
1125727367 15:41874886-41874908 GGCCATGCCATGGGCCATGGAGG + Exonic
1125768655 15:42151052-42151074 GGCCCTGCCCAGAGCCTGTGGGG + Intronic
1125886173 15:43231158-43231180 GGCCAGGCCCTGAGCCAGGTAGG - Intergenic
1126738148 15:51751909-51751931 GACCAGGCGCTGCGCCCGGGCGG + Intronic
1126948406 15:53851627-53851649 GGCCGTGCCCTGTACCCTGGAGG + Intergenic
1127373449 15:58361127-58361149 GGCTATGGCCTGAGCCCCTGTGG - Intronic
1127787823 15:62371726-62371748 GGTCCTGCCCTGTGCCCTGGGGG - Intergenic
1128672796 15:69586888-69586910 GACCATTCCCTGTGCCAGGGTGG - Intergenic
1129465797 15:75723627-75723649 GGGCATGTCCAGAGCCTGGGAGG + Intergenic
1131009106 15:89002698-89002720 GGCCACCCCCTGACCCCGGCAGG + Intergenic
1131189352 15:90301359-90301381 GGCCATGAACTCAGCCCGGAAGG - Intronic
1131323498 15:91420689-91420711 GGACATGCCCTGGGCCAGAGGGG - Intergenic
1132030486 15:98434892-98434914 GGGGATGGCTTGAGCCCGGGAGG + Intergenic
1132235577 15:100217968-100217990 GAGGATGCCCTGAGCCCGGGAGG - Intronic
1132253228 15:100350091-100350113 GGCCATTCCCAGAGCCAGGCAGG - Intergenic
1132674663 16:1116748-1116770 GGCCACGTCCTGCTCCCGGGAGG - Intergenic
1132752646 16:1465876-1465898 GCCCCTGCCCTGAGCTGGGGCGG - Intronic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1132806886 16:1779008-1779030 GGGACTGCCCTGAGGCCGGGTGG - Intronic
1132997039 16:2828839-2828861 GGAGATGCCGAGAGCCCGGGTGG - Intergenic
1133241519 16:4416769-4416791 GGCCACGCCCTGATACCGAGGGG + Intronic
1133525930 16:6605678-6605700 GGCCCTGCCCAGAGCCTGGCGGG - Intronic
1134090893 16:11391167-11391189 GGCCCTGCCCAGCGCCAGGGTGG - Intronic
1135053505 16:19211713-19211735 GGGAATGCCGTGAACCCGGGAGG - Intronic
1136007472 16:27340901-27340923 GGCCCTGCACTGAGCCTGGCGGG + Intronic
1136857954 16:33676451-33676473 GGAGATTGCCTGAGCCCGGGAGG - Intergenic
1137405960 16:48189712-48189734 GGCCACCCCCAGAGGCCGGGTGG + Intronic
1137674160 16:50295795-50295817 TGCCAGGCCCTGAGTCTGGGTGG + Intronic
1139163299 16:64536985-64537007 GCGCATGCCCTGAACCCAGGAGG - Intergenic
1139465296 16:67150904-67150926 GACCCTGCGCTGAGCCCCGGAGG - Exonic
1140470359 16:75210428-75210450 GAGCATGGCTTGAGCCCGGGAGG + Intergenic
1140608669 16:76571550-76571572 GAGAATGGCCTGAGCCCGGGAGG + Intronic
1141644567 16:85360351-85360373 GCCCCTGCCCTGCGGCCGGGTGG + Intergenic
1142348147 16:89567037-89567059 GAGGATGGCCTGAGCCCGGGAGG + Intergenic
1143563937 17:7710202-7710224 GCCCATGGCCTGAGCTGGGGTGG - Exonic
1147428824 17:40359160-40359182 GGCAATGGCGTGAACCCGGGAGG - Intergenic
1147690366 17:42311286-42311308 GGCCATGTCCTTAGCACAGGGGG + Exonic
1148238415 17:45984096-45984118 GGCCACAGCCTGAGCACGGGAGG - Intronic
1148860319 17:50601183-50601205 GGCCTTGCCCTGAGCGGGGCTGG - Intronic
1149470295 17:56910817-56910839 GGCAATGCCCTTAGCCTCGGGGG - Intronic
1149649872 17:58269995-58270017 AGCCATGGCCTGAGCCTGGCTGG + Exonic
1149714005 17:58769524-58769546 GAGGCTGCCCTGAGCCCGGGAGG + Intronic
1150003160 17:61454616-61454638 AGGCAAACCCTGAGCCCGGGAGG + Intronic
1150095118 17:62367175-62367197 GGGGATCACCTGAGCCCGGGAGG + Intergenic
1151184151 17:72351108-72351130 GGCCAGGCCGGGAGACCGGGTGG + Intergenic
1151277531 17:73046849-73046871 GGGCATCGCTTGAGCCCGGGCGG + Intronic
1151677320 17:75605345-75605367 GGGAATGGCCTGAACCCGGGAGG + Intergenic
1152394397 17:80023663-80023685 AGCCACGCCCTGAGCCGGTGGGG - Intronic
1152459511 17:80433789-80433811 GGCCAGGCCCTCAGCTGGGGAGG - Intronic
1152488538 17:80612776-80612798 GGGCATCACCTGAGCCCAGGAGG + Intronic
1153922474 18:9804016-9804038 AGCTCTGCCCTGAGCCCGGGAGG + Intronic
1155597306 18:27502730-27502752 GGACCTGCCCTGGGCCAGGGAGG + Intergenic
1155919698 18:31591054-31591076 GAGGATGACCTGAGCCCGGGAGG + Intergenic
1157759825 18:50253104-50253126 GGGAATGGCGTGAGCCCGGGAGG - Intronic
1158138999 18:54236845-54236867 GGCAATGGCATGAACCCGGGAGG + Intergenic
1158893361 18:61893467-61893489 AGCCATGCCCCGACCCCAGGCGG + Exonic
1158962168 18:62596339-62596361 GGCCAAGCCGTGCGACCGGGTGG + Intergenic
1159885534 18:73900621-73900643 GGCCCTACCCTGAGCCCCAGGGG - Intergenic
1160258732 18:77270422-77270444 GGGGATCACCTGAGCCCGGGAGG + Exonic
1160292743 18:77609218-77609240 GGTCAGGTCCTGAGCCTGGGCGG - Intergenic
1160419053 18:78731767-78731789 GTCCCTGCCCTGAATCCGGGCGG + Intergenic
1160586312 18:79915332-79915354 GGCCCTGGCCTGGCCCCGGGGGG - Intronic
1160863592 19:1248012-1248034 GGCTATGCTGTGACCCCGGGAGG - Intergenic
1161028250 19:2046486-2046508 GGCCATGTCCTGAGCCCCCTGGG - Intronic
1161313698 19:3608189-3608211 GGCCCAGCCCTGACCCCAGGGGG - Intergenic
1161388557 19:4009471-4009493 GACCCTGCCCTCAGCCAGGGTGG - Intronic
1161431083 19:4232951-4232973 GCCCATGCCCTGCCCCCGGGGGG + Intronic
1161466378 19:4432958-4432980 GGCCATGCCCCAAGCCTCGGTGG + Intronic
1162347090 19:10125325-10125347 GGCAATCCCTTGAACCCGGGAGG + Intergenic
1162836663 19:13323549-13323571 GACGATCCCTTGAGCCCGGGAGG - Intronic
1163144323 19:15370332-15370354 GGCCCTGTCCTGAGCCCCGGAGG - Intronic
1163237276 19:16037162-16037184 GGCCACACCCTGAGCCCCGGAGG + Intergenic
1163405602 19:17120187-17120209 GGCACTGCCCTGAGCCCAGAGGG - Intronic
1163430459 19:17264168-17264190 GGCCCTGCTCTGAGCCAGGCAGG + Intronic
1163478511 19:17540506-17540528 GTCCATGCCTTGAGCCAGGAGGG - Exonic
1164229475 19:23274916-23274938 GGGAATGGCCTGAACCCGGGAGG - Intergenic
1164575064 19:29401081-29401103 TCCCATGCCCAGAGGCCGGGCGG - Intergenic
1165091346 19:33389782-33389804 GGCCTTGCCCTGTGCCCGCTGGG - Intronic
1165355203 19:35299960-35299982 GGCCATGCCCAGGGCCAGGCAGG + Intronic
1167015853 19:46840548-46840570 GGAGATGACCTGAGCCTGGGAGG + Intronic
1167424442 19:49422857-49422879 GGCCATGCGCTGAGCGCTGTGGG - Intronic
1167479067 19:49718093-49718115 GGCAATGGCATGAACCCGGGAGG + Intergenic
1167502445 19:49855634-49855656 GGCCATGACCTGGACCCGGGGGG + Intronic
1167574153 19:50309744-50309766 GGCCATCCCCGGAGCCTGAGGGG + Exonic
1167593025 19:50414678-50414700 AGCCGTGCCCTGAGCCTGGTGGG - Intronic
1167798857 19:51727477-51727499 GGACATCTCCTGAGCCCTGGTGG + Intergenic
1168039216 19:53744557-53744579 GAGAATGGCCTGAGCCCGGGAGG + Intergenic
1168277893 19:55287141-55287163 GCCCCTGCCCTCAGCCCCGGAGG - Intronic
1168407402 19:56118082-56118104 GCCCAAGCTCTGAGCCCAGGTGG - Intronic
925274977 2:2642170-2642192 AGCCCTGCCATGAACCCGGGGGG - Intergenic
929055851 2:37875448-37875470 GGCCATGCACTGAAACGGGGTGG - Intergenic
929532442 2:42761563-42761585 GGAGCTGCCCTGAGCCCAGGTGG + Intergenic
929966921 2:46543017-46543039 GACCATGCCCGGAGGCCGGCCGG + Exonic
932970291 2:76532718-76532740 GGGGATGGCCTGAGCCTGGGTGG + Intergenic
936173695 2:110199531-110199553 GGGCATCCCTTGAGCCTGGGAGG + Intronic
936281807 2:111147901-111147923 GGCCATGCCCTGCTCCCACGGGG - Intronic
936825417 2:116576324-116576346 GGACCTGCCCTGAGCCATGGGGG - Intergenic
937855618 2:126670415-126670437 GGCCCTGCCATGAGCCAGTGAGG + Intronic
937866184 2:126753230-126753252 GCCCATGCACTGAGCATGGGTGG - Intergenic
938301041 2:130213498-130213520 GACCATGCCCGGAGGCCGGCGGG - Intergenic
938455679 2:131460969-131460991 GACCATGCCCGGAGGCCGGCGGG + Intergenic
938896002 2:135751274-135751296 GAGAATGCCGTGAGCCCGGGAGG - Intronic
939309766 2:140460971-140460993 GGCCATCGCTTGAACCCGGGAGG + Intronic
940633706 2:156271003-156271025 TGCCATGCCCTGGGACCAGGTGG - Intergenic
943650889 2:190456539-190456561 GGCCATGCCATCAGCCCTGCAGG - Intronic
946181337 2:217950879-217950901 GGCCATGAGCAGAGCCCTGGAGG - Intronic
946846734 2:223865758-223865780 GGAGATGCCTTGAGCCCTGGAGG + Intronic
946899331 2:224357020-224357042 GGGAATGGCGTGAGCCCGGGAGG + Intergenic
947758563 2:232587150-232587172 GGCCATTCCCAGAGCCCCAGGGG - Intergenic
948053132 2:234993032-234993054 GGCCTTGCCCACAGCCTGGGAGG + Intronic
948065153 2:235072710-235072732 GACAATGGCCTGAACCCGGGAGG + Intergenic
948087442 2:235263267-235263289 GAGGATCCCCTGAGCCCGGGAGG + Intergenic
948206975 2:236167675-236167697 CGCCATGCCCTGCGCCAGGCTGG + Exonic
948252031 2:236537037-236537059 GGCCTTGCCCTGGGCCCTGCAGG + Intergenic
948863560 2:240764308-240764330 GGCCCTGCCCTGAGCCCCACAGG + Intronic
1168917157 20:1499698-1499720 GGACATGCCCAGAGCCTGAGGGG - Intergenic
1168963343 20:1883587-1883609 TGCCCTGCCCGGAGCCAGGGTGG + Intergenic
1169189717 20:3650494-3650516 GGGCATGCCCTGAGGCCAGGAGG - Exonic
1169197940 20:3693378-3693400 GGCCATGCCGTGATCCCTGTGGG + Intronic
1169381662 20:5112901-5112923 GGACACGCCCAGAGCCCGAGAGG + Intronic
1170766097 20:19291143-19291165 GGCCCTGCCCTCAGCCCCAGGGG - Intronic
1172183936 20:33019928-33019950 GGCCATGCCAAGAGCCAGGGTGG - Intronic
1172186710 20:33035514-33035536 GGCCATCCCAAGAGCCCTGGTGG - Intronic
1173233292 20:41219715-41219737 GGCAAGGCCCAGAGCCCTGGTGG - Intronic
1173707572 20:45123894-45123916 GGCCATACCCTGAGCCAGGATGG - Exonic
1174687332 20:52468468-52468490 GGCAAAGCCCTGAGGCTGGGAGG + Intergenic
1176078242 20:63258949-63258971 GGCCAGGCTCTGAGCCAGAGAGG - Intronic
1176136528 20:63524791-63524813 GAGGATCCCCTGAGCCCGGGAGG + Intergenic
1176917593 21:14644761-14644783 GGACATGCCCTGGGCCAGAGGGG + Intronic
1177761461 21:25406870-25406892 GGACCTGCCCTGAGCCAGAGCGG - Intergenic
1177879498 21:26674801-26674823 GACAATGGCTTGAGCCCGGGAGG + Intergenic
1178905343 21:36631867-36631889 GGGAATCACCTGAGCCCGGGAGG - Intergenic
1179381798 21:40906144-40906166 TGCCATACCCTGGTCCCGGGTGG - Intergenic
1179472852 21:41623039-41623061 GCCCATGCCCTGAGCCACGAGGG - Intergenic
1180078509 21:45475411-45475433 GGCCAGGCCCCGAGCCCGGCAGG - Intronic
1181417387 22:22770456-22770478 GACCATGACCTGAGACCTGGAGG + Intronic
1181517566 22:23423959-23423981 GGAGATGGCCTGGGCCCGGGAGG + Intergenic
1181568653 22:23754358-23754380 GGCCATGGCCAGAGGCAGGGAGG + Exonic
1181645083 22:24226570-24226592 TGCCAAGTCCTGAGCCAGGGAGG + Intronic
1182742068 22:32575097-32575119 CGCCATGCCGGGAGCCCGGCTGG + Intronic
1183482254 22:38071613-38071635 GGCCTTGCCCTGGGCCAGTGTGG + Intronic
1183744827 22:39686236-39686258 GGCCAGGCCGTGGGCCAGGGCGG - Exonic
1183951689 22:41356210-41356232 GGCCAGGCCCTGAGGCTGAGCGG + Intronic
1184101823 22:42344787-42344809 GGCCAGGCCCAGAGCCAGGACGG - Intergenic
1184790242 22:46695704-46695726 GGCCAAGCCCTGAGGCAGGTGGG - Intronic
1185065343 22:48629215-48629237 GGCCAGGCCCTGAGGGTGGGAGG - Intronic
950424406 3:12917005-12917027 GGCTATGCCCTGAGCAGGTGGGG + Intronic
950444502 3:13028527-13028549 GGCTCTGCCCTGACCCCGGTTGG - Intronic
952644505 3:35639409-35639431 CGCGTTGCCCTCAGCCCGGGCGG + Intronic
953025380 3:39142094-39142116 GCCCATGCCCTGAGGCCAGTTGG - Exonic
953392009 3:42539418-42539440 GTCCTTCCCCTGAGCCCAGGGGG - Intergenic
953806896 3:46078310-46078332 GGCCAGGCGCTGAGTCTGGGAGG - Intergenic
954473663 3:50722859-50722881 GAGCATGCCTTGAGCCCAGGAGG - Intronic
954642990 3:52113272-52113294 GACCCTGCCCTGGGCCTGGGTGG + Intronic
955080826 3:55656495-55656517 GGCCTGGCCTTGAGTCCGGGAGG + Intronic
955193034 3:56779580-56779602 GTCCATGGCGTGAACCCGGGAGG - Intronic
955219895 3:57014768-57014790 GACAATGGCCTGAGCCTGGGAGG - Intronic
956843162 3:73158335-73158357 GGCCATACCCTGAGGAGGGGAGG + Intergenic
957929556 3:86861142-86861164 GAGAATGCCCTGAACCCGGGAGG - Intergenic
958412183 3:93831844-93831866 GAGAATGCCCTGAACCCGGGAGG - Intergenic
959409038 3:105997647-105997669 GGACATGCCCTGGGCCAGAGGGG - Intergenic
961038972 3:123663689-123663711 GGCCATCCCCAGAGCCTGGAGGG + Intronic
961722746 3:128907364-128907386 GGCCCTTCCCTTAGCCTGGGAGG + Intronic
962728209 3:138255290-138255312 GAGAATGGCCTGAGCCCGGGAGG - Intronic
962740603 3:138360491-138360513 GGCCATGCCCTGGGTGCTGGTGG + Intronic
964120724 3:153180446-153180468 GAGGATGCCTTGAGCCCGGGAGG - Intergenic
966303177 3:178501119-178501141 GAGAATGCCGTGAGCCCGGGAGG + Intronic
967891725 3:194368728-194368750 GGTGATGCCCTGGGCCCGGGAGG + Intronic
968135303 3:196216302-196216324 GCCCCTGCCCTGGGCCGGGGTGG - Intronic
968474804 4:799192-799214 GGCCCTGCCCCGTGCCCTGGAGG + Intronic
968563790 4:1298676-1298698 GGCCAAGGACTGAGCCCGGGGGG - Intronic
968618561 4:1593196-1593218 GGCCAAGCCCTGGACCCGCGAGG - Intergenic
968625869 4:1626476-1626498 GGCCATGCCCTGAGCCCGGGGGG + Intronic
968625889 4:1626538-1626560 AGCCATGCCCTGAGCCCGGGGGG + Intronic
968625919 4:1626650-1626672 GGCCATGCCCTGAGCCCGGGGGG + Intronic
969483753 4:7460255-7460277 TGCCATGCCCTAAGCCCCAGAGG + Intronic
969496910 4:7531434-7531456 GCCCCTGCCCTGTGCCCGTGCGG - Intronic
969509641 4:7610462-7610484 TGCCATGCAATGAACCCGGGGGG - Intronic
973919732 4:55673107-55673129 GCCCAGGCCCTGAGGCAGGGAGG - Intergenic
975252679 4:72198034-72198056 AGACATGCCCTGAGCCAGAGGGG + Intergenic
978361112 4:107931821-107931843 GGCCAGGGCGTGGGCCCGGGCGG - Exonic
979158580 4:117429598-117429620 GGAGTTGCCCTGAGCCCAGGCGG + Intergenic
982564667 4:156971890-156971912 GGCCGTGGGCCGAGCCCGGGCGG + Intergenic
984801333 4:183719634-183719656 GAGCATGGCCTGAACCCGGGAGG + Intergenic
985286888 4:188344977-188344999 GGCCCTGCCCTGAGTCCCGTTGG - Intergenic
985520791 5:373247-373269 GGCCCTGCCCTGCACCCGGCTGG + Intronic
985743662 5:1634435-1634457 GAGGATGGCCTGAGCCCGGGAGG + Intergenic
986137848 5:4999359-4999381 GGCAAAGCCCTGAGCCTTGGTGG - Intergenic
986671456 5:10146579-10146601 GGCCTTGTCCTGAGCCAGGAGGG + Intergenic
986858863 5:11903905-11903927 GACCTTGCCCTGAAGCCGGGCGG - Exonic
987103713 5:14616448-14616470 GGCCAAGCCCTGCGCCAGTGGGG + Intergenic
987922008 5:24295622-24295644 GAGAATGCCCTGAACCCGGGAGG - Intergenic
989147052 5:38259010-38259032 CGCCCTCCCCCGAGCCCGGGCGG + Intronic
989504816 5:42215405-42215427 GGACCTGCCCTGAGCCAGAGGGG - Intergenic
989963304 5:50440961-50440983 GGCGATGCCCTCTGCCCGCGGGG + Intronic
990905802 5:60801611-60801633 GACGATGGCTTGAGCCCGGGAGG + Intronic
996089888 5:119340404-119340426 AGGCATGCCCTGCTCCCGGGAGG + Intronic
997463565 5:134071792-134071814 GGCCTTGCCCTTAGCCCTTGTGG + Intergenic
997884972 5:137621874-137621896 GCCTATGCCCTGAGCAAGGGGGG - Exonic
998149262 5:139747625-139747647 GGCCCTGCCCGCAGCCCGGCCGG + Intergenic
999076066 5:148796748-148796770 GAGCATGGCTTGAGCCCGGGAGG + Intergenic
1000632100 5:163602364-163602386 GAGGATGCCTTGAGCCCGGGAGG - Intergenic
1002046432 5:176543926-176543948 GGCCATGCCCTGGTCCAGGTTGG - Intronic
1002639424 5:180623659-180623681 GGCCAGGCCATGAGCCCCTGAGG - Intronic
1003385138 6:5660556-5660578 GGGGATCCCCTGAGCCCAGGAGG + Intronic
1003643944 6:7899116-7899138 GGCCCAGCCCTGACCCCAGGTGG + Intronic
1005332241 6:24761404-24761426 GCCCAGGTCCTGAGCCTGGGAGG + Intergenic
1006704267 6:36004163-36004185 GACGATTCCCTGAGCCTGGGAGG - Intronic
1009590505 6:65663769-65663791 GGAAATGGCCTGAACCCGGGAGG - Intronic
1010080589 6:71856661-71856683 GGGAATGGCGTGAGCCCGGGAGG - Intergenic
1010252054 6:73717707-73717729 GAGAATGCCCTGAACCCGGGAGG - Intronic
1010776803 6:79896182-79896204 GGCCTTGGCCTGGGCTCGGGAGG + Intergenic
1012164402 6:95930199-95930221 GAGCATCACCTGAGCCCGGGGGG - Intergenic
1012249823 6:96967850-96967872 GGGCATGCCCTGAGGCAGGAAGG + Intronic
1013237176 6:108207395-108207417 GGGGATCCCCTGAGCCTGGGAGG - Intergenic
1013599481 6:111691132-111691154 GGCCAGGCCCTGAGCCTGTGAGG - Intronic
1016012276 6:139149713-139149735 GGGCTTGCCCTGAGACCGGCAGG - Intronic
1017333381 6:153225798-153225820 GACCATTGCTTGAGCCCGGGAGG - Intergenic
1018635244 6:165854715-165854737 AGGCCTGGCCTGAGCCCGGGAGG + Intronic
1018997356 6:168720063-168720085 GGACATCCCCTGACCCCAGGTGG + Intergenic
1020102159 7:5399977-5399999 GGCGATTGCTTGAGCCCGGGAGG - Intronic
1022326492 7:29336869-29336891 TGCCAGGCCCTGTGCCAGGGAGG - Intronic
1028269844 7:88774930-88774952 GGCTATGCCTTGAGGCTGGGTGG + Intronic
1029164244 7:98575440-98575462 GGGGATGGCCTGAGCCTGGGAGG - Intergenic
1029348969 7:99999448-99999470 GGCCAAGGCTTGAGCCCAGGAGG - Intergenic
1029465124 7:100720622-100720644 GCCCCTGCTCTGACCCCGGGTGG + Intergenic
1029708278 7:102286707-102286729 GGCCATCCGCGGAGCCCGAGCGG - Intronic
1029732777 7:102448625-102448647 GGCAATGGCGTGAACCCGGGAGG + Exonic
1031011186 7:116526243-116526265 GGGCCTGCCCTGACCCCTGGCGG + Intronic
1031695723 7:124850639-124850661 GAGAATGCCCTGAACCCGGGAGG + Intronic
1031903574 7:127436989-127437011 GGCCATCACCTGAGCCCAGGAGG - Intergenic
1032057317 7:128694055-128694077 GGCCATGCACAGAGCCAAGGAGG + Intergenic
1032114241 7:129103421-129103443 GGCCAAGCCCTGAGACTGGCTGG + Intergenic
1033128552 7:138726077-138726099 GAGAATGGCCTGAGCCCGGGAGG - Intronic
1033559351 7:142516444-142516466 GGCTGTGCCCTGAGCCCAGTGGG + Intergenic
1034680628 7:152925296-152925318 GGGCTTGCCCTGGGCCTGGGAGG + Intergenic
1034932339 7:155172405-155172427 AGCCCTGCCCTGAGCCTGGCTGG + Intergenic
1035084502 7:156246820-156246842 GGACCTGCCCTGAGCCAGAGGGG - Intergenic
1035236518 7:157500922-157500944 CGTCATGCCCCGAGCCCTGGAGG - Intergenic
1035236532 7:157500971-157500993 CGTCATGCCCCGAGCCCTGGAGG - Intergenic
1035236547 7:157501020-157501042 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236562 7:157501069-157501091 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236577 7:157501118-157501140 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236591 7:157501164-157501186 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236606 7:157501213-157501235 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236621 7:157501262-157501284 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236636 7:157501311-157501333 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035242493 7:157541351-157541373 GCGCATGCCCTGAGCCAGGAGGG - Intronic
1035427990 7:158794685-158794707 GGGAATCCACTGAGCCCGGGGGG + Intronic
1035579605 8:731621-731643 GGCCATTCCCTGTGTCCGGCGGG - Intronic
1035579731 8:732003-732025 GGCCATGCCCTGTGTCCAGCAGG - Intronic
1041199319 8:55435657-55435679 GGGCATTGCTTGAGCCCGGGAGG - Intronic
1041240690 8:55846627-55846649 GAGGATCCCCTGAGCCCGGGAGG + Intergenic
1041912303 8:63102067-63102089 GATCATGGCCTGAGCCCAGGAGG + Intergenic
1041912309 8:63102089-63102111 GACCATGGCTTGAGCCCAGGAGG + Intergenic
1042192333 8:66199746-66199768 GGCCAAGCCCTGATTCCAGGAGG + Intergenic
1042548581 8:69973215-69973237 GAGAATGGCCTGAGCCCGGGAGG - Intergenic
1043864365 8:85358667-85358689 GGCCATGCCCTGAGTCAGTAAGG - Intronic
1044193047 8:89342432-89342454 GGACCTGCCCTGAGCCAGAGGGG - Intergenic
1044835043 8:96287586-96287608 GGCCATGCCCTGGGTCACGGTGG + Intronic
1045007432 8:97928566-97928588 AGCCAAGCCCTGAGCCCCAGGGG - Intronic
1045485515 8:102628106-102628128 GGCCTTGCCCTGACCCAGGCAGG - Intergenic
1045754613 8:105528124-105528146 GGAGAAGCCCTGAGCCCAGGTGG + Intronic
1047777922 8:128088940-128088962 TGCCAGGCCCTGACCCCAGGAGG + Intergenic
1048306413 8:133287703-133287725 GGGGCTGCCCTGAGCACGGGAGG + Intronic
1049090727 8:140511697-140511719 GGCAGTGCCCAGAGCCCGGCGGG - Intronic
1049216203 8:141409497-141409519 GGCGATGCCCAGAGCCCCTGAGG + Intronic
1049372540 8:142274669-142274691 GGCCCTGCCCTGTGCCTGGGAGG - Intronic
1049577105 8:143394485-143394507 GGCCAGGCCTTGACCCCAGGTGG - Intergenic
1049693918 8:143974533-143974555 GGCCAGGTGCTGAGCCCTGGGGG - Intronic
1049762675 8:144338163-144338185 GGCCCCGCGCGGAGCCCGGGTGG + Intergenic
1049838418 8:144754972-144754994 GGCCAGAGCCAGAGCCCGGGGGG + Intronic
1050300885 9:4257661-4257683 GGGAATGGCCTGAACCCGGGAGG - Intronic
1051610993 9:18961258-18961280 GAGGATGGCCTGAGCCCGGGAGG - Intronic
1052258312 9:26485412-26485434 GAGAATGCCCTGAACCCGGGAGG - Intergenic
1052295299 9:26890853-26890875 GGGAATGGCCTGAACCCGGGAGG + Intronic
1053477762 9:38394375-38394397 GGCAATCACCTGAGCCCAGGAGG - Intronic
1055554904 9:77464088-77464110 GGCAATGACTTGAGCCCAGGAGG - Intronic
1056064482 9:82919445-82919467 GGCCATGCCTTGAACTCAGGTGG - Intergenic
1056475393 9:86947215-86947237 GGCGAGGCACTGAGCCCAGGAGG - Intergenic
1056560641 9:87726418-87726440 GGCCAGGCCCTGAGTCGGCGCGG - Intronic
1056643450 9:88389083-88389105 GGCCATCCCCCGGGCCTGGGAGG - Intronic
1056684586 9:88749038-88749060 GGCCAGGCCCTGCTCCCTGGAGG + Intergenic
1057277226 9:93682324-93682346 GGCCCTGCCCTGCCCCCCGGTGG - Intergenic
1057442012 9:95090059-95090081 GGCTATGCCCTGAGGCTGCGTGG + Intergenic
1058297939 9:103332365-103332387 GAGGATGCCTTGAGCCCGGGAGG + Intergenic
1058391118 9:104496726-104496748 GGCAATGGCATGAACCCGGGAGG - Intergenic
1058692888 9:107534205-107534227 GGGCATTACCTGAGCCCGGGAGG + Intergenic
1059140730 9:111850939-111850961 GAGGATGCCCTGAGCCTGGGAGG - Intergenic
1059218800 9:112592277-112592299 GGAGATTGCCTGAGCCCGGGAGG + Intronic
1059441290 9:114308516-114308538 TGCCAGGCCCTGAGCCAGGACGG + Intronic
1060741895 9:126104243-126104265 GGCCAGCCCCTGGGCCCTGGGGG + Intergenic
1061736567 9:132664617-132664639 GGGCATCACCTGAGCCCGGGAGG + Intronic
1061754402 9:132802611-132802633 CGCCATGCCCGGTGCCTGGGAGG - Intronic
1062165398 9:135105047-135105069 GGCCTGGCCCAGAGCCCGTGTGG + Intronic
1062312145 9:135944639-135944661 GGCCCTGCCCAGAGACCGGGAGG - Intronic
1062502726 9:136858259-136858281 GGCCCTGCCCTCAGCCAGGTGGG + Exonic
1062707749 9:137954579-137954601 GGCCATGCCCTGAGAATGAGAGG - Intronic
1203792411 EBV:158975-158997 GGCCAGGCCCTGCCCCCGGATGG - Intergenic
1185774951 X:2794573-2794595 GGCCGTGGCCTGGGCCTGGGCGG - Exonic
1188749979 X:33893278-33893300 GGACTTGCCCTGAGCCAGAGGGG - Intergenic
1189226253 X:39415657-39415679 GGCTGAGCCCTGAGCCTGGGAGG + Intergenic
1190712346 X:53079924-53079946 GCCCAGGCCCTGAGCACGGGAGG + Exonic
1191259062 X:58292732-58292754 GCCCCTGCACTGAGCCCGGAAGG + Intergenic
1194663410 X:96651118-96651140 GGCGATCCCCTGAGCCCAGGAGG - Intergenic
1195905525 X:109840571-109840593 TGCCATGCCCTGGGCCTGTGAGG + Intergenic
1198153566 X:133934600-133934622 GGGGATCCCCTGAGCCTGGGAGG - Intronic
1198328794 X:135602101-135602123 GGGAATGGCCTGAACCCGGGAGG - Intergenic
1198346808 X:135767631-135767653 TGAAATGACCTGAGCCCGGGGGG - Intronic
1198348715 X:135784915-135784937 TGAAATGACCTGAGCCCGGGGGG - Intergenic
1198350620 X:135802189-135802211 TGAAATGACCTGAGCCCGGGGGG - Intronic
1198352527 X:135819452-135819474 TGAAATGACCTGAGCCCGGGGGG - Intronic
1198354436 X:135836720-135836742 TGAAATGACCTGAGCCCGGGGGG - Intronic
1198356346 X:135853978-135854000 TGAAATGACCTGAGCCCGGGGGG - Intronic
1198358259 X:135871252-135871274 TGAAATGACCTGAGCCCGGGGGG - Intergenic
1198360173 X:135888526-135888548 TGAAATGACCTGAGCCCGGGGGG - Intronic
1198478235 X:137016594-137016616 GGTCATGACCTGACCCTGGGGGG + Intergenic
1199845285 X:151688449-151688471 GGACCTGCCCTGAGCCAGAGGGG + Intergenic
1199927361 X:152481061-152481083 CGACTTGCCCAGAGCCCGGGAGG + Intergenic
1200184449 X:154173064-154173086 GGGGATCCCTTGAGCCCGGGAGG - Intergenic
1200190101 X:154210202-154210224 GGGGATCCCTTGAGCCCGGGAGG - Intergenic
1200195854 X:154248004-154248026 GGGGATCCCTTGAGCCCGGGAGG - Intergenic
1200201508 X:154285122-154285144 GGGGATCCCTTGAGCCCGGGAGG - Intronic
1202272286 Y:23083667-23083689 GGCCATACCCTGAGGGAGGGAGG + Intergenic
1202293740 Y:23337015-23337037 GGCCATACCCTGAGGGAGGGAGG - Intergenic
1202425283 Y:24717411-24717433 GGCCATACCCTGAGGGAGGGAGG + Intergenic
1202445506 Y:24952674-24952696 GGCCATACCCTGAGGGAGGGAGG - Intergenic